G414278



Basic Information


Item Value
gene id G414278
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 52952113 ~ 52952486 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU469598
acaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggcaaagtcaaagtccagacctgaatccaatcaagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatgtcagtctctcgatgtgcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaactgaagggggctgaataattttgcacacccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU469598 True 374 lncRNA 0.38 1 52952113 52952486

Neighbor


gene id symbol gene type direction distance location
ptprsa LOC106613507 coding downstream 264067 52404727 ~ 52688046 (-)
LOC110524020 LOC106613504 coding downstream 578712 52351810 ~ 52373401 (-)
LOC110524019 LOC106613502 coding downstream 665403 52264521 ~ 52286710 (-)
LOC110524016 LOC100380721 coding downstream 752265 52172054 ~ 52199848 (-)
actl6a acl6b coding downstream 805717 52132002 ~ 52146396 (-)
kdm4b LOC101448002 coding upstream 293659 53246145 ~ 53333935 (-)
LOC110524026 LOC106613510 coding upstream 381847 53334333 ~ 53376599 (-)
LOC118964771 NA coding upstream 392594 53345080 ~ 53345217 (-)
LOC110522968 LOC106613459 coding upstream 770904 53723390 ~ 53734904 (-)
LOC118964619 LOC106613459 coding upstream 788158 53740644 ~ 53745563 (-)
G414263 NA non-coding downstream 8139 52943615 ~ 52943974 (-)
G414209 NA non-coding downstream 49577 52902187 ~ 52902536 (-)
G414199 NA non-coding downstream 54827 52897015 ~ 52897286 (-)
G414186 NA non-coding downstream 63369 52888532 ~ 52888744 (-)
G414176 NA non-coding downstream 75750 52876125 ~ 52876363 (-)
G414292 NA non-coding upstream 8665 52961151 ~ 52961446 (-)
G414325 NA non-coding upstream 35405 52987891 ~ 52988108 (-)
G414468 NA non-coding upstream 130665 53083151 ~ 53083929 (-)
G414477 NA non-coding upstream 146794 53099280 ~ 53099632 (-)
G414487 NA non-coding upstream 158389 53110875 ~ 53111104 (-)
G412613 NA other downstream 1339551 51558378 ~ 51612562 (-)
G412372 NA other downstream 1574983 51373465 ~ 51377130 (-)
LOC110524003 LOC106613485 other downstream 1767338 51179758 ~ 51228505 (-)
G411930 NA other downstream 2228036 50723159 ~ 50724077 (-)
G411929 NA other downstream 2229052 50722314 ~ 50723061 (-)
G415256 LOC106613513 other upstream 665197 53617683 ~ 53618864 (-)
G415420 NA other upstream 938274 53890760 ~ 53892906 (-)
G415464 nexn other upstream 1051245 54002448 ~ 54005673 (-)
G416110 NA other upstream 1410800 54363286 ~ 54392411 (-)
LOC110524071 LOC106613554 other upstream 2188829 55123617 ~ 55181458 (-)

Expression


G414278 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G414278 Expression in each Bioproject

Bar chart with 20 bars.
G414278 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network