G414286


Basic Information

Item Value
gene id G414286
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 52956795 ~ 52957517 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU469606
accttggacgagcttctttgttggcactcctatatgtcccataaacatcacaattgggtatttttcccgattaaatccgtcattgtatacccaaaatgtaatttgctgaaggccagtctgatgctgcaaaaagtccatttacaagacgcaacgtcactttttaaaattacaaaagtcgcctataaacttttacaaatcacttcaaacgacgtttctaaaccaactttaggtattaataaacgttaatgatgcatcaaattgatcacggggcgatctgtattcgatagcagcaagtctggaaaacatcgtccattttttcagtttcacaacatactgtggtgcgtcagaagaagggaggggtctattcgtgttgtaaccagggataaatgattctgatattgatagcaatggtgacatcgtgtggaagctgtaggcgtttacagggggttcgcatatattttctctcgtcttaaacaattcattgaatggcggacaaatatttttgttttgtttttggtaaacagttttaccagggatttttactcctaaacacgttctgttatagccacagacccgatttaaccagttttagaaacttcagagtgttttctatccacacatacttatcatatgcatatactatattcctggcatgagtagcaggactttgaaatgttgcgcgatttttaacaaaaagctgcgaaaattcgcatcatccataac

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU469606 True 723 lncRNA 0.38 1 52956795 52957517
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118964714 NA coding upstream 60678 52875720 ~ 52896117 (+)
LOC110524018 LOC105026225 coding upstream 693739 52254713 ~ 52263056 (+)
LOC118964618 NA coding upstream 707900 52246773 ~ 52248895 (+)
LOC110524017 ftsj3 coding upstream 721499 52230095 ~ 52235296 (+)
plaat1 LOC106613501 coding upstream 726774 52222828 ~ 52230021 (+)
opa1 LOC106613511 coding downstream 446252 53403769 ~ 53462256 (+)
LOC110524030 LOC106613513 coding downstream 659010 53616527 ~ 53618565 (+)
LOC110524032 LOC106613514 coding downstream 809253 53766770 ~ 53801558 (+)
LOC110524034 LOC106613518 coding downstream 870438 53827955 ~ 53923888 (+)
LOC110524036 LOC106573996 coding downstream 971749 53929266 ~ 53940832 (+)
G414266 NA non-coding upstream 11089 52945420 ~ 52945706 (+)
G414257 NA non-coding upstream 17829 52938740 ~ 52938966 (+)
G414251 NA non-coding upstream 20836 52935737 ~ 52935959 (+)
G414228 NA non-coding upstream 42436 52914091 ~ 52914359 (+)
G414223 NA non-coding upstream 46265 52910313 ~ 52910530 (+)
G414291 NA non-coding downstream 3695 52961212 ~ 52961442 (+)
G414482 NA non-coding downstream 147518 53105035 ~ 53105325 (+)
G414491 NA non-coding downstream 158950 53116467 ~ 53116828 (+)
G414492 NA non-coding downstream 160098 53117615 ~ 53117916 (+)
G414499 NA non-coding downstream 165693 53123210 ~ 53123507 (+)
G414041 NA other upstream 177316 52778517 ~ 52779479 (+)
G414007 NA other upstream 195066 52761389 ~ 52761729 (+)
G412859 NA other upstream 1153975 51802250 ~ 51802820 (+)
camsap2a camsap2 other upstream 1818411 51059834 ~ 51153381 (+)
G411519 NA other upstream 2293155 50662872 ~ 50663640 (+)
G414488 LOC106562530 other downstream 154666 53112183 ~ 53112507 (+)
G415582 LOC106584099 other downstream 1220412 54177929 ~ 54183430 (+)
G415808 NA other downstream 1371678 54329195 ~ 54329780 (+)
G415809 NA other downstream 1372563 54330080 ~ 54330480 (+)
mutyh mutyh other downstream 1389019 54346481 ~ 54395448 (+)

Expression

G414286 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G414286 Expression in each Bioproject

Bar chart with 19 bars.
G414286 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network