G415748



Basic Information


Item Value
gene id G415748
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 54266063 ~ 54266343 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU471195
ctatacagtgccttgcgaaagtattcggcccccttgaactttgtgaccttttgccacatttcaggcttcaaacataaagatataaaactgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgccaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU471195 True 281 lncRNA 0.37 1 54266063 54266343
Loading

Neighbor


gene id symbol gene type direction distance location
obscna LOC106613530 coding upstream 97105 54083355 ~ 54168958 (+)
zgc:153738 LOC106613531 coding upstream 208688 54049039 ~ 54057375 (+)
LOC110524043 NA coding upstream 241559 54019945 ~ 54024504 (+)
LOC118964527 NA coding upstream 247453 54016607 ~ 54018708 (+)
LOC110524041 LOC106613525 coding upstream 260857 53991256 ~ 54005206 (+)
mutyh mutyh coding downstream 80138 54346481 ~ 54395448 (+)
LOC110524051 LOC106613536 coding downstream 107861 54374204 ~ 54378738 (+)
dio1 dio1 coding downstream 281170 54547513 ~ 54550162 (+)
LOC110522872 LOC106613984 coding downstream 286012 54552355 ~ 54554389 (+)
LOC118964620 NA coding downstream 323615 54589958 ~ 54595332 (+)
G415552 LOC106613532 non-coding upstream 90977 54169117 ~ 54175086 (+)
G415550 NA non-coding upstream 184197 54081625 ~ 54081866 (+)
G415547 NA non-coding upstream 186391 54079469 ~ 54079672 (+)
G415543 NA non-coding upstream 188159 54077636 ~ 54077904 (+)
G415750 LOC106613533 non-coding downstream 42492 54308835 ~ 54312141 (+)
G415807 NA non-coding downstream 62056 54328399 ~ 54328696 (+)
G415812 LOC106562530 non-coding downstream 67474 54333817 ~ 54334053 (+)
G415819 NA non-coding downstream 78532 54344875 ~ 54345101 (+)
G415582 LOC106584099 other upstream 82633 54177929 ~ 54183430 (+)
G414488 LOC106562530 other upstream 1153556 53112183 ~ 53112507 (+)
G414041 NA other upstream 1486584 52778517 ~ 52779479 (+)
G414007 NA other upstream 1504334 52761389 ~ 52761729 (+)
G412859 NA other upstream 2463243 51802250 ~ 51802820 (+)
G415808 NA other downstream 62852 54329195 ~ 54329780 (+)
G415809 NA other downstream 63737 54330080 ~ 54330480 (+)
G415946 NA other downstream 323731 54590074 ~ 54613142 (+)
G416857 NA other downstream 1058302 55324645 ~ 55325271 (+)

Expression


G415748 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G415748 Expression in each Bioproject

Bar chart with 18 bars.
G415748 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network