G415812 (LOC106562530)



Basic Information


Item Value
gene id G415812
gene name LOC106562530
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 54333817 ~ 54334053 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU471264
gtgtgtgttggggtaccagccggtcctggcaccatggcatccgggccagaccgaggctcctgcggtggaggaatgggtacagcgctccaaggagacctggagggccgtccaggaatctctacaacaagcgagtggacggcagaagaggagtgctgaccgccaccgcagtgaggcccccgtatttgtaccgggggacagggtctggctctcgacccgaaacctacctctccgcttgcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU471264 True 237 lncRNA 0.64 1 54333817 54334053
Loading

Neighbor


gene id symbol gene type direction distance location
obscna LOC106613530 coding upstream 164859 54083355 ~ 54168958 (+)
zgc:153738 LOC106613531 coding upstream 276442 54049039 ~ 54057375 (+)
LOC110524043 NA coding upstream 309313 54019945 ~ 54024504 (+)
LOC118964527 NA coding upstream 315207 54016607 ~ 54018708 (+)
LOC110524041 LOC106613525 coding upstream 328611 53991256 ~ 54005206 (+)
mutyh mutyh coding downstream 12428 54346481 ~ 54395448 (+)
LOC110524051 LOC106613536 coding downstream 40151 54374204 ~ 54378738 (+)
dio1 dio1 coding downstream 213460 54547513 ~ 54550162 (+)
LOC110522872 LOC106613984 coding downstream 218302 54552355 ~ 54554389 (+)
LOC118964620 NA coding downstream 255905 54589958 ~ 54595332 (+)
G415807 NA non-coding upstream 5121 54328399 ~ 54328696 (+)
G415750 LOC106613533 non-coding upstream 21676 54308835 ~ 54312141 (+)
G415748 NA non-coding upstream 67474 54266063 ~ 54266343 (+)
G415552 LOC106613532 non-coding upstream 158731 54169117 ~ 54175086 (+)
G415550 NA non-coding upstream 251951 54081625 ~ 54081866 (+)
G415819 NA non-coding downstream 10822 54344875 ~ 54345101 (+)
G415886 NA non-coding downstream 124177 54458230 ~ 54496389 (+)
G415887 NA non-coding downstream 168982 54503035 ~ 54513549 (+)
G415914 NA non-coding downstream 221023 54555076 ~ 54556336 (+)
G415809 NA other upstream 3337 54330080 ~ 54330480 (+)
G415808 NA other upstream 4037 54329195 ~ 54329780 (+)
G415582 LOC106584099 other upstream 150387 54177929 ~ 54183430 (+)
G414488 LOC106562530 other upstream 1221310 53112183 ~ 53112507 (+)
G414041 NA other upstream 1554338 52778517 ~ 52779479 (+)
G415946 NA other downstream 256021 54590074 ~ 54613142 (+)
G416857 NA other downstream 990592 55324645 ~ 55325271 (+)
G418077 LOC106613582 other downstream 2283837 56617890 ~ 56628617 (+)
G418119 LOC106613588 other downstream 2392132 56726185 ~ 56729821 (+)

Expression


G415812(LOC106562530) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G415812(LOC106562530) Expression in each Bioproject

Bar chart with 14 bars.
G415812(LOC106562530) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network