G416100



Basic Information


Item Value
gene id G416100
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 54338100 ~ 54338309 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU471628
gtgattgtctatgttagtggcttgtgtcagcacaggtctcattttgtagcttcacggtcgaatttggtttattgtttttgttactcttttgtatagtgttcagtctttctttattaaagattttaccatggacacttaccacgccgcatattggtcctctgatccttctcgcctctcctcttcagacgaagaggaggacgaccgtgacag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU471628 True 210 lncRNA 0.43 1 54338100 54338309

Neighbor


gene id symbol gene type direction distance location
LOC110524048 NA coding downstream 10392 54326233 ~ 54327989 (-)
LOC110524047 LOC106613533 coding downstream 18631 54310588 ~ 54319469 (-)
LOC110522971 NA coding downstream 32268 54301980 ~ 54305832 (-)
LOC110522871 LOC106613983 coding downstream 37043 54297793 ~ 54301057 (-)
LOC110522970 LOC106613460 coding downstream 88880 54200190 ~ 54249220 (-)
LOC110524050 LOC106613535 coding upstream 39814 54378123 ~ 54543804 (-)
ssbp3b ssbp3 coding upstream 216742 54555051 ~ 54587190 (-)
erich3 erich3 coding upstream 301972 54640281 ~ 54661854 (-)
slc44a5b LOC106613541 coding upstream 379017 54717326 ~ 54770286 (-)
LOC110524065 elov7 coding upstream 560787 54899096 ~ 54924752 (-)
G416095 NA non-coding downstream 7399 54330351 ~ 54330701 (-)
G415772 NA non-coding downstream 71433 54266427 ~ 54266667 (-)
G415652 NA non-coding downstream 220823 54113974 ~ 54117277 (-)
G415649 LOC106613530 non-coding downstream 221706 54113046 ~ 54116394 (-)
G416106 NA non-coding upstream 12979 54351288 ~ 54351689 (-)
G416107 NA non-coding upstream 13621 54351930 ~ 54352374 (-)
G416111 mutyh non-coding upstream 17213 54355522 ~ 54356155 (-)
G416110 NA non-coding upstream 24977 54363286 ~ 54392411 (-)
G416123 NA non-coding upstream 39374 54377683 ~ 54381094 (-)
G415464 nexn other downstream 332427 54002448 ~ 54005673 (-)
G415420 NA other downstream 445194 53890760 ~ 53892906 (-)
G415256 LOC106613513 other downstream 719236 53617683 ~ 53618864 (-)
G412613 NA other downstream 2725538 51558378 ~ 51612562 (-)
G412372 NA other downstream 2960970 51373465 ~ 51377130 (-)
LOC110524071 LOC106613554 other upstream 803006 55123617 ~ 55181458 (-)
G417527 NA other upstream 1270526 55608835 ~ 55609730 (-)
LOC110522975 LOC106613586 other upstream 2370489 56703896 ~ 56711499 (-)
G418830 NA other upstream 2495717 56834026 ~ 56834595 (-)

Expression


G416100 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G416100 Expression in each Bioproject

Bar chart with 16 bars.
G416100 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network