G418680



Basic Information


Item Value
gene id G418680
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 56593948 ~ 56594224 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU474539
tccacccccatgcttcacagtaggtatggtgttctttggatggaactcagcattctttgtcctccaaacacgacgagttgagtttttaccaaaaagttattttggtttcatctgaccatatgacattctcccaatcttcttctggatcatccaaatgctctctagcaaacttcagacgggcctggacatgtactggcttaagcagggggacacgtctggcactgcaggatttgagtccctggcggcgtagtgtgttactgatggtaggctttgttac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU474539 True 277 lncRNA 0.47 1 56593948 56594224
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110524093 LOC106613579 coding downstream 13455 56578635 ~ 56580493 (-)
LOC118964624 NA coding downstream 47254 56510467 ~ 56546694 (-)
LOC118964625 NA coding downstream 88510 56501839 ~ 56505438 (-)
LOC110524090 LOC106613576 coding downstream 108082 56460779 ~ 56485866 (-)
LOC110524089 LOC106613577 coding downstream 134435 56456115 ~ 56459513 (-)
si:dkey-121a11.3 LOC106613582 coding upstream 8659 56602883 ~ 56630974 (-)
LOC110522975 LOC106613586 coding upstream 109672 56703896 ~ 56711499 (-)
LOC110524100 LOC106613588 coding upstream 131950 56726174 ~ 56729842 (-)
LOC110524101 LOC106613589 coding upstream 195409 56789633 ~ 56817065 (-)
LOC100136253 LOC100526765 coding upstream 244283 56838507 ~ 56842447 (-)
G418671 NA non-coding downstream 683 56589030 ~ 56593265 (-)
G418679 LOC106613581 non-coding downstream 6293 56587182 ~ 56587655 (-)
G418622 LOC106613464 non-coding downstream 47286 56502541 ~ 56546662 (-)
G418617 NA non-coding downstream 50575 56490748 ~ 56543373 (-)
G418599 NA non-coding downstream 157481 56435991 ~ 56436467 (-)
G418686 NA non-coding upstream 5466 56599690 ~ 56600991 (-)
G418687 NA non-coding upstream 7764 56601988 ~ 56602797 (-)
G418749 NA non-coding upstream 92860 56687084 ~ 56688572 (-)
G418689 LOC106613587 non-coding upstream 103976 56698200 ~ 56702162 (-)
G417527 NA other downstream 984218 55608835 ~ 55609730 (-)
LOC110524071 LOC106613554 other downstream 1433681 55123617 ~ 55181458 (-)
G416110 NA other downstream 2207720 54363286 ~ 54392411 (-)
G415464 nexn other downstream 2588275 54002448 ~ 54005673 (-)
G415420 NA other downstream 2701042 53890760 ~ 53892906 (-)
G418830 NA other upstream 239802 56834026 ~ 56834595 (-)
G419603 NA other upstream 1016835 57611059 ~ 57611567 (-)
LOC110524128 LOC107602773 other upstream 1025830 57612040 ~ 57627128 (-)
G419714 NA other upstream 1105521 57699745 ~ 57705936 (-)

Expression


G418680 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G418680 Expression in each Bioproject

Bar chart with 20 bars.
G418680 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network