G421616



Basic Information


Item Value
gene id G421616
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 59718025 ~ 59718250 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU477769
CTACAATATATGTTTGAAATAGCCCTATTTAATGTGGTTTGAATGTTTATGAGATATTTATATTCATTTTTATCAGGTCCATAACAGAAAAAAAGGGCTTGTTGATTGTTTAAAACATGCTATTCACAATGAACAACATAACCTCTGGAATTCCTGCTAAACCCATCACTTCATAGACCAGGGGAAAAACTGTGCTGTCCTTTCCAGAAAACATCTGCTGTTAAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU477769 True 226 lncRNA 0.34 1 59718025 59718250
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110524187 LOC106613668 coding upstream 56784 59643783 ~ 59661241 (+)
LOC110524186 LOC106613996 coding upstream 122689 59591060 ~ 59595336 (+)
LOC110524183 cgl coding upstream 254118 59456364 ~ 59463907 (+)
srsf11 LOC106613665 coding upstream 359360 59350779 ~ 59358665 (+)
LOC110524179 NA coding upstream 548695 59167253 ~ 59169330 (+)
LOC110524191 LOC106613674 coding downstream 22966 59741216 ~ 59744639 (+)
LOC110524195 LOC106613677 coding downstream 83778 59802028 ~ 59821970 (+)
LOC110524196 LOC106613678 coding downstream 108825 59827075 ~ 59838227 (+)
LOC110524197 LOC106613680 coding downstream 151440 59869690 ~ 59880569 (+)
LOC110524198 LOC106613681 coding downstream 171369 59889619 ~ 59904034 (+)
G421614 LOC106613672 non-coding upstream 5226 59710617 ~ 59712799 (+)
G421517 NA non-coding upstream 52133 59664724 ~ 59665892 (+)
G421372 NA non-coding upstream 357025 59359916 ~ 59361000 (+)
G421376 NA non-coding upstream 358459 59359082 ~ 59359566 (+)
G421362 NA non-coding upstream 370494 59340051 ~ 59347531 (+)
LOC110524190 LOC106613673 non-coding downstream 14687 59714706 ~ 59734498 (+)
G421627 NA non-coding downstream 21569 59739819 ~ 59740031 (+)
G421574 NA non-coding downstream 26516 59744766 ~ 59745075 (+)
G421570 NA non-coding downstream 43667 59761917 ~ 59762428 (+)
G420634 NA other upstream 773808 58942728 ~ 58944217 (+)
G420117 LOC100846954 other upstream 1301249 58411240 ~ 58418268 (+)
G419452 NA other upstream 1818377 57884380 ~ 57899648 (+)
LOC110524119 LOC106613607 other upstream 2350688 57352343 ~ 57367627 (+)
LOC100135807 LOC106613594 other upstream 2759860 56943838 ~ 56958165 (+)
LOC110524226 LOC106573564 other downstream 976007 60694220 ~ 60695905 (+)
G423922 NA other downstream 2003287 61721537 ~ 61722024 (+)
G424079 NA other downstream 2387273 62105523 ~ 62105872 (+)
LOC110524265 LOC106613745 other downstream 2564902 62283054 ~ 62327772 (+)
G425224 NA other downstream 3326840 63045090 ~ 63051530 (+)

Expression


G421616 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G421616 Expression in each Bioproject

Bar chart with 10 bars.
G421616 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network