G422347



Basic Information


Item Value
gene id G422347
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 60100765 ~ 60101056 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU478587
ggtacattccagctcctcgtatcggccgggctagagtgggcatcgagccaggtgccatgaagccggctctacgcatctggtctccagtgcgtctccttgggccggcgtacatggcaccatccttacgcatggtgtccccggttcgccagcacagcccagtgcggcctattccacctcgccgcactggtcgggctacggggagcattcaaccaggtaaggttgtgcaggctcggtgctcaagagctccagtgcgcctgcacggtccggtctatccagtgccacctccacgcac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU478587 True 292 TUCP 0.64 1 60100765 60101056
Loading

Neighbor


gene id symbol gene type direction distance location
klf2a LOC106613686 coding downstream 119146 59979007 ~ 59981619 (-)
LOC118964630 NA coding downstream 186489 59904845 ~ 59914276 (-)
LOC110524194 LOC106613679 coding downstream 299561 59787744 ~ 59801204 (-)
LOC110524193 LOC106613676 coding downstream 324109 59772761 ~ 59776656 (-)
LOC110524192 LOC106613675 coding downstream 345946 59745476 ~ 59754819 (-)
LOC110524206 ap1m1 coding upstream 15474 60116530 ~ 60134272 (-)
LOC110524209 LOC106613694 coding upstream 181318 60282374 ~ 60289431 (-)
lpl lpl coding upstream 197148 60298204 ~ 60306640 (-)
LOC110524214 LOC106613699 coding upstream 293968 60395024 ~ 60398862 (-)
LOC118964632 NA coding upstream 313107 60414163 ~ 60426534 (-)
G422346 NA non-coding downstream 393 60100136 ~ 60100372 (-)
G422342 NA non-coding downstream 5962 60094526 ~ 60094803 (-)
G422335 NA non-coding downstream 15451 60080695 ~ 60085314 (-)
G422294 NA non-coding downstream 85666 60014867 ~ 60015099 (-)
G422286 NA non-coding downstream 100329 60000166 ~ 60000436 (-)
G422356 NA non-coding upstream 8815 60109871 ~ 60110102 (-)
G422357 NA non-coding upstream 9620 60110676 ~ 60110974 (-)
G422359 NA non-coding upstream 10564 60111620 ~ 60111836 (-)
G422360 NA non-coding upstream 11879 60112935 ~ 60113573 (-)
G422363 LOC106613690 non-coding upstream 33760 60134816 ~ 60135590 (-)
lsg1 lsg1 other downstream 962508 59131152 ~ 59138429 (-)
G420982 LOC106613655 other downstream 1064466 59026103 ~ 59036299 (-)
G420421 NA other downstream 1686622 58413128 ~ 58414143 (-)
G420193 NA other downstream 1986705 58112387 ~ 58114060 (-)
G419714 NA other downstream 2394829 57699745 ~ 57705936 (-)
LOC110524239 LOC106573579 other upstream 957938 61058949 ~ 61081864 (-)
G424474 NA other upstream 1515814 61616870 ~ 61617244 (-)
G424499 LOC106613729 other upstream 1548911 61649967 ~ 61651775 (-)
G424502 NA other upstream 1557977 61659033 ~ 61659585 (-)
G424649 NA other upstream 1787142 61888198 ~ 61927422 (-)

Expression


G422347 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G422347 Expression in each Bioproject

Bar chart with 20 bars.
G422347 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network