G423202



Basic Information


Item Value
gene id G423202
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 60593903 ~ 60594197 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU479515
cgccagggactcaaatcctgcagtgccagacgtgtccccctgcttaagccagtacatgtccaggcccgtctgaagtttgctagagagcatttggatgatccaaaagaagattgggagaatgtcatatggtcagatgaaaccaaaatataactttttggtataaactcaactcgtcgtgtttggaggacaaagaatgctgagttgcatccaaagaacaccatacctactgtgaagcatgggggtggaaacatcatgctttggggctgtttttctgcaaagggaacaggacgactga

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU479515 True 295 lncRNA 0.46 1 60593903 60594197

Neighbor


gene id symbol gene type direction distance location
LOC110524219 LOC106613704 coding downstream 80423 60509679 ~ 60513480 (-)
LOC110524218 LOC106613703 coding downstream 117455 60471312 ~ 60476448 (-)
ccl44 LOC106613702 coding downstream 131709 60459847 ~ 60462194 (-)
LOC118964632 NA coding downstream 167369 60414163 ~ 60426534 (-)
LOC110524214 LOC106613699 coding downstream 195041 60395024 ~ 60398862 (-)
LOC110524222 LOC106613707 coding upstream 11011 60605208 ~ 60626475 (-)
ndufa11 LOC106613708 coding upstream 84501 60678698 ~ 60682883 (-)
cers4a LOC106613711 coding upstream 101706 60695903 ~ 60728972 (-)
LOC110524228 LOC106573568 coding upstream 267250 60861447 ~ 60884008 (-)
timm44 LOC106613715 coding upstream 308201 60902398 ~ 60914281 (-)
G423200 NA non-coding downstream 1078 60592615 ~ 60592825 (-)
G423180 NA non-coding downstream 18130 60556269 ~ 60575773 (-)
G423155 NA non-coding downstream 27490 60505662 ~ 60566413 (-)
G423154 NA non-coding downstream 86176 60505192 ~ 60507727 (-)
G423205 NA non-coding upstream 1818 60596015 ~ 60596282 (-)
G423230 NA non-coding upstream 33192 60627389 ~ 60627595 (-)
G423246 NA non-coding upstream 57175 60651372 ~ 60652062 (-)
G423251 NA non-coding upstream 105852 60700049 ~ 60704571 (-)
G422347 NA other downstream 492847 60100765 ~ 60101056 (-)
lsg1 lsg1 other downstream 1455646 59131152 ~ 59138429 (-)
G420982 LOC106613655 other downstream 1557604 59026103 ~ 59036299 (-)
G420421 NA other downstream 2179760 58413128 ~ 58414143 (-)
G420193 NA other downstream 2479843 58112387 ~ 58114060 (-)
LOC110524239 LOC106573579 other upstream 464797 61058949 ~ 61081864 (-)
G424474 NA other upstream 1022673 61616870 ~ 61617244 (-)
G424499 LOC106613729 other upstream 1055770 61649967 ~ 61651775 (-)
G424502 NA other upstream 1064836 61659033 ~ 61659585 (-)
G424649 NA other upstream 1294001 61888198 ~ 61927422 (-)

Expression


G423202 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G423202 Expression in each Bioproject

Bar chart with 20 bars.
G423202 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network