G423357



Basic Information


Item Value
gene id G423357
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 60840630 ~ 60841048 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU479687
GAGGAGCCGTCGGGGCTCAGCTGGTGTCCGGGGGGACATTCACACTCGTAACTCCCCTCTGTGTTCAGACAGGCGCCTCCTTGACACAGCAGTGTGTTCCTCTCACACTCATCAACCCATGCAGTTCTTCATCATCATGAAGCCGCTCTCGTAGCCCTCGAAGCATTCACACTCGAAGCTGCCGGGGGTGTTCACACAGGTGCCGTGGCCACACAGGTCCGGAGAGATA

Function


NR:

description
LOW QUALITY PROTEIN: fibrillin-2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU479687 True 229 lncRNA 0.59 2 60840630 60841048

Neighbor


gene id symbol gene type direction distance location
cers4a LOC106613711 coding downstream 111658 60695903 ~ 60728972 (-)
ndufa11 LOC106613708 coding downstream 157747 60678698 ~ 60682883 (-)
LOC110524222 LOC106613707 coding downstream 214155 60605208 ~ 60626475 (-)
LOC110524219 LOC106613704 coding downstream 327150 60509679 ~ 60513480 (-)
LOC110524218 LOC106613703 coding downstream 364182 60471312 ~ 60476448 (-)
LOC110524228 LOC106573568 coding upstream 20399 60861447 ~ 60884008 (-)
timm44 LOC106613715 coding upstream 61350 60902398 ~ 60914281 (-)
LOC110524230 hnrpm coding upstream 73969 60915017 ~ 60930663 (-)
LOC110524231 LOC106613717 coding upstream 102959 60944007 ~ 60951642 (-)
LOC110524236 rb11b coding upstream 111857 60952905 ~ 60966146 (-)
G423328 NA non-coding downstream 28175 60812197 ~ 60812455 (-)
G423326 NA non-coding downstream 30755 60809637 ~ 60809875 (-)
G423291 NA non-coding downstream 96129 60744272 ~ 60744501 (-)
G423251 NA non-coding downstream 136059 60700049 ~ 60704571 (-)
G423363 NA non-coding upstream 5862 60846910 ~ 60847364 (-)
G423364 NA non-coding upstream 10055 60851103 ~ 60851699 (-)
G423365 NA non-coding upstream 11108 60852156 ~ 60852488 (-)
G423361 NA non-coding upstream 13535 60854583 ~ 60855115 (-)
G423360 NA non-coding upstream 14212 60855260 ~ 60855923 (-)
G422347 NA other downstream 739574 60100765 ~ 60101056 (-)
lsg1 lsg1 other downstream 1702373 59131152 ~ 59138429 (-)
G420982 LOC106613655 other downstream 1804331 59026103 ~ 59036299 (-)
G420421 NA other downstream 2426487 58413128 ~ 58414143 (-)
G420193 NA other downstream 2726570 58112387 ~ 58114060 (-)
LOC110524239 LOC106573579 other upstream 217946 61058949 ~ 61081864 (-)
G424474 NA other upstream 775822 61616870 ~ 61617244 (-)
G424499 LOC106613729 other upstream 808919 61649967 ~ 61651775 (-)
G424502 NA other upstream 817985 61659033 ~ 61659585 (-)
G424649 NA other upstream 1047150 61888198 ~ 61927422 (-)

Expression


G423357 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

G423357 Expression in each Bioproject

Bar chart with 1 bar.
G423357 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 0.4.
End of interactive chart.

Co-expression Network