G424474



Basic Information


Item Value
gene id G424474
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 61616870 ~ 61617244 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU480894
ggcgcgaaggacgggcttgatgcaggagacatggaagaccgggtggacgcgacgaaggtatcgcggaagaagaagtcgaactgcgacaggattaatgacccgagaaatacggaacggaccaatgaaccgcggggtcaacttgcgagaagccgtcttaaggagaaggttctgagtggagagccaaactctctgaccgcgacaatatctaggactcttagttctacgcttattagcagccctcacagtctgcgccctataacggcaaagtgcagacctgaccctcttccaggtgcgctcgcaacgttggacaaaagcctgagcggaggggacgctggactcggcgaactgagatgagaacagcggaggctggtaccc

Function


NR:

description
PREDICTED: uncharacterized protein LOC107670948

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU480894 True 375 TUCP 0.56 1 61616870 61617244

Neighbor


gene id symbol gene type direction distance location
LOC110522983 LOC106613725 coding downstream 105792 61304113 ~ 61511078 (-)
trnaa-agc-3 NA coding downstream 350101 61266697 ~ 61266769 (-)
LOC110524243 LOC106613723 coding downstream 374864 61139319 ~ 61242006 (-)
tjp3 LOC106613722 coding downstream 484989 61104757 ~ 61131881 (-)
arhgap45b LOC106613721 coding downstream 520484 61082638 ~ 61096386 (-)
LOC110524247 LOC106613727 coding upstream 743 61617987 ~ 61622355 (-)
LOC110524249 LOC106613730 coding upstream 42905 61660149 ~ 61679106 (-)
LOC110524252 LOC106613733 coding upstream 145874 61763118 ~ 61786542 (-)
tssk6 LOC106613736 coding upstream 224317 61841561 ~ 61842727 (-)
si:ch211-212d10.2 LOC106613739 coding upstream 416845 62033465 ~ 62037994 (-)
G424471 NA non-coding downstream 5300 61611298 ~ 61611570 (-)
G424467 NA non-coding downstream 9407 61603707 ~ 61607463 (-)
G424464 NA non-coding downstream 14596 61601882 ~ 61602274 (-)
G424463 NA non-coding downstream 15177 61601272 ~ 61601693 (-)
G424462 NA non-coding downstream 15758 61600754 ~ 61601112 (-)
G424483 NA non-coding upstream 11032 61628276 ~ 61628498 (-)
G424487 NA non-coding upstream 19869 61637113 ~ 61637366 (-)
G424497 NA non-coding upstream 32204 61649448 ~ 61649651 (-)
G424500 NA non-coding upstream 34778 61652022 ~ 61652284 (-)
LOC110524239 LOC106573579 other downstream 545727 61058949 ~ 61081864 (-)
G422347 NA other downstream 1515814 60100765 ~ 60101056 (-)
lsg1 lsg1 other downstream 2478613 59131152 ~ 59138429 (-)
G420982 LOC106613655 other downstream 2580571 59026103 ~ 59036299 (-)
G420421 NA other downstream 3202727 58413128 ~ 58414143 (-)
G424499 LOC106613729 other upstream 32723 61649967 ~ 61651775 (-)
G424502 NA other upstream 41789 61659033 ~ 61659585 (-)
G424649 NA other upstream 270954 61888198 ~ 61927422 (-)
G424678 NA other upstream 381282 61998526 ~ 62001309 (-)
LOC110524277 LOC106613757 other upstream 1186694 62803832 ~ 62808176 (-)

Expression


G424474 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G424474 Expression in each Bioproject

Bar chart with 18 bars.
G424474 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network