G429599



Basic Information


Item Value
gene id G429599
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 66767693 ~ 66767896 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU486642
gatgcaaccagtcaggatgctctcgatgttgcagctgtataactttttgaggatctcaggacccatgccaaatctttttagttacctgagggggaataggctttgtcgtgccctcttcacgactgtcttggtgtgtttggaccattctagtttgttgttgatgtggacaccaaggaactagaagctctcaacctgcttcactac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU486642 True 204 lncRNA 0.47 1 66767693 66767896

Neighbor


gene id symbol gene type direction distance location
LOC118964717 LOC106584253 coding downstream 3193 66752126 ~ 66764500 (-)
LOC110524390 LOC106613856 coding downstream 30944 66720762 ~ 66736749 (-)
LOC110524389 LOC106584359 coding downstream 90984 66666537 ~ 66676709 (-)
LOC110524385 NA coding downstream 108555 66653328 ~ 66659138 (-)
LOC110524386 NA coding downstream 246321 66514473 ~ 66521372 (-)
LOC110524398 LOC106613863 coding upstream 18941 66786837 ~ 66793995 (-)
cep19 cep19 coding upstream 31732 66799628 ~ 66801724 (-)
aqp12 LOC106613865 coding upstream 115793 66883689 ~ 66885402 (-)
ankmy1 ankmy1 coding upstream 287763 66978887 ~ 67068645 (-)
LOC118936331 dnajc19 coding upstream 743556 67511452 ~ 67513347 (-)
G429593 NA non-coding downstream 6058 66761380 ~ 66761635 (-)
G429588 NA non-coding downstream 12351 66755125 ~ 66755342 (-)
G429574 NA non-coding downstream 18841 66744888 ~ 66748852 (-)
G429572 NA non-coding downstream 26236 66741070 ~ 66741457 (-)
G429565 NA non-coding downstream 29560 66729360 ~ 66738133 (-)
G429583 NA non-coding upstream 17041 66784937 ~ 66785490 (-)
G429580 NA non-coding upstream 42117 66810013 ~ 66812758 (-)
G429617 NA non-coding upstream 70280 66838176 ~ 66839233 (-)
G429620 NA non-coding upstream 114146 66882042 ~ 66882304 (-)
G428132 NA other downstream 1385103 65370116 ~ 65382590 (-)
G427902 ubxn6 other downstream 1756095 64999708 ~ 65011598 (-)
LOC110524332 LOC106613803 other downstream 1856695 64903039 ~ 64911196 (-)
LOC110524330 LOC106613802 other downstream 2034721 64701867 ~ 64810664 (-)
G427287 NA other downstream 2199313 64566681 ~ 64568380 (-)
lrrc7 LOC106613881 other upstream 1042709 67810595 ~ 67983549 (-)
bend5 LOC106584333 other upstream 1572308 68331871 ~ 68352828 (-)
G432310 LOC106613894 other upstream 1931925 68699821 ~ 68707448 (-)
G432338 NA other upstream 1982321 68748558 ~ 68755057 (-)

Expression


G429599 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G429599 Expression in each Bioproject

Bar chart with 15 bars.
G429599 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network