G431912



Basic Information


Item Value
gene id G431912
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 68092177 ~ 68092382 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU489171
atttttcctatgttgttgccttataacctggaattaaaatagatttttggggggtttgtgtcatttgatttacacaacatgcctgccactttgaagatgcaaaatatgttttaattgtgaaacaaacaagaaataagacaaaaaaactgaaaacttgagagtgcataactattcaccccacaaagtcaatactttgtagagccacc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU489171 True 206 lncRNA 0.33 1 68092177 68092382
Loading

Neighbor


gene id symbol gene type direction distance location
si:ch211-198n5.11 LOC106613885 coding downstream 82583 68002085 ~ 68009594 (-)
lrrc7 LOC106613881 coding downstream 108628 67810595 ~ 67983549 (-)
LOC118936331 dnajc19 coding downstream 578830 67511452 ~ 67513347 (-)
ankmy1 ankmy1 coding downstream 1023532 66978887 ~ 67068645 (-)
aqp12 LOC106613865 coding downstream 1206775 66883689 ~ 66885402 (-)
slc5a9 slc5a9 coding upstream 91844 68184226 ~ 68190916 (-)
spata6 spata6 coding upstream 122618 68215000 ~ 68231509 (-)
agbl4 LOC100286605 coding upstream 141739 68234121 ~ 68643132 (-)
bend5 LOC106584333 coding upstream 239489 68331871 ~ 68352828 (-)
LOC110524428 LOC106613895 coding upstream 723580 68815962 ~ 68819009 (-)
G431910 NA non-coding downstream 1666 68090217 ~ 68090511 (-)
G431902 NA non-coding downstream 8174 68083791 ~ 68084003 (-)
G431896 NA non-coding downstream 13237 68078665 ~ 68078940 (-)
G431882 NA non-coding downstream 26860 68064897 ~ 68065317 (-)
LOC110524417 LOC106613888 non-coding downstream 37634 68052730 ~ 68114236 (-)
G431913 NA non-coding upstream 85 68092467 ~ 68092666 (-)
G431926 NA non-coding upstream 22396 68114778 ~ 68114995 (-)
G431931 NA non-coding upstream 29718 68122100 ~ 68122323 (-)
G431944 NA non-coding upstream 46671 68139053 ~ 68139422 (-)
G431958 NA non-coding upstream 64549 68156931 ~ 68157131 (-)
LOC110524398 LOC106613863 other downstream 1302341 66786837 ~ 66793995 (-)
G428132 NA other downstream 2709587 65370116 ~ 65382590 (-)
G427902 ubxn6 other downstream 3080579 64999708 ~ 65011598 (-)
LOC110524332 LOC106613803 other downstream 3181179 64903039 ~ 64911196 (-)
G432310 LOC106613894 other upstream 607439 68699821 ~ 68707448 (-)
G432338 NA other upstream 657835 68748558 ~ 68755057 (-)
G432513 NA other upstream 912237 69004619 ~ 69006106 (-)
G433683 LOC106613912 other upstream 1430432 69486406 ~ 69524790 (-)

Expression


G431912 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G431912 Expression in each Bioproject

Bar chart with 16 bars.
G431912 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network