G433670 (cep350)



Basic Information


Item Value
gene id G433670
gene name cep350
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 69469764 ~ 69470321 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU491063
TGCCACTTTGCGCACTTTAGCTGTGGGTGCGGTGGTTTTCTCCACAGCTCCAGCGATGCCCACTGTCTGATCCAGGTACCCCAGCAACCCGTCTCTCTCTGCAGCCTCCTCCAGGTGCTCTCTCTGCCTGCGGATCCGCTCCTTCAGCTTCTCCAGCTTGTCATCCGGCTGCCTTCGCCTTAAGTTTTCCAGCCGCTGGGAGGCTGAGCCAGGACTGGAGGACGAAGAGTTCTCTGCTGAGGGTGGTGCCAGGCACTCCAGGGTGTGTGCTTTGGGCCTGTCCTCCGGGCCCTCCTCCCTGTGAGGGTCTCTGGCTGCAGTAGCGTGGCTTGGGGGACGCAGGGTGTCCAGCGCGGGCCGGTCGTTGAGGTAGCGCACCACGGTGCTGTCCAGAGCAGACGAGTGTGTGCTGTCCAGGTCTCGGCGGGTTTGCTGGTCTCGGGTGTCGCTCTGGTAGACCAGCTGGCTGAGACGGAAGTCCGGGGGAGGGGGGTTAGCCACCTCCGACTGCAGACTGTGGGCCTCCAGCTGGGAGGAGGTCAGGGGTGGTGGAGTCGC

Function


symbol description
cep350 Predicted to enable microtubule binding activity. Predicted to act upstream of or within microtubule anchoring. Predicted to be located in centrosome. Orthologous to human CEP350 (centrosomal protein 350).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU491063 True 558 lncRNA 0.64 1 69469764 69470321

Neighbor


gene id symbol gene type direction distance location
LOC110524442 LOC106613910 coding downstream 119213 69239531 ~ 69350551 (-)
si:dkey-21p1.3 LOC106613908 coding downstream 241095 69198487 ~ 69228669 (-)
soat1 soat1 coding downstream 271505 69187862 ~ 69198259 (-)
LOC110524437 abl2 coding downstream 282503 69143474 ~ 69187261 (-)
LOC110524436 LOC106613904 coding downstream 334673 69086959 ~ 69135091 (-)
LOC110524447 LOC106613914 coding upstream 81482 69551803 ~ 69619075 (-)
LOC110524449 LOC106613916 coding upstream 234550 69704871 ~ 69714330 (-)
LOC110524450 k0841 coding upstream 244961 69715282 ~ 69728426 (-)
LOC110524451 LOC106613917 coding upstream 268042 69738363 ~ 69743354 (-)
LOC110524454 rfc4 coding upstream 274265 69744586 ~ 69751448 (-)
G433669 NA non-coding downstream 392 69469043 ~ 69469372 (-)
G432448 NA non-coding downstream 319938 69147630 ~ 69149826 (-)
LOC110522990 LOC106613902 non-coding downstream 415880 69050540 ~ 69054216 (-)
G432389 NA non-coding downstream 642114 68826974 ~ 68827650 (-)
G433680 NA non-coding upstream 14016 69484337 ~ 69484789 (-)
G433682 NA non-coding upstream 15873 69486194 ~ 69486404 (-)
G433683 LOC106613912 non-coding upstream 16085 69486406 ~ 69524790 (-)
G433688 NA non-coding upstream 19129 69489450 ~ 69489758 (-)
G433697 NA non-coding upstream 32193 69502514 ~ 69504926 (-)
G432513 NA other downstream 463658 69004619 ~ 69006106 (-)
G432338 NA other downstream 714707 68748558 ~ 68755057 (-)
G432310 LOC106613894 other downstream 762316 68699821 ~ 68707448 (-)
bend5 LOC106584333 other downstream 1117019 68331871 ~ 68352828 (-)
lrrc7 LOC106613881 other downstream 1651640 67810595 ~ 67983549 (-)
G435234 NA other upstream 1520571 70990892 ~ 70991798 (-)
G435176 NA other upstream 1597704 71068025 ~ 71068887 (-)
LOC110524478 LOC106613944 other upstream 1758861 71226012 ~ 71242283 (-)
il23r LOC106613945 other upstream 1816069 71285725 ~ 71308015 (-)

Expression


G433670(cep350) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.3.
End of interactive chart.

G433670(cep350) Expression in each Bioproject

Bar chart with 5 bars.
G433670(cep350) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1.5.
End of interactive chart.

Co-expression Network