G433814



Basic Information


Item Value
gene id G433814
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 69729555 ~ 69729792 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU491232
CTATTGGTAGTAGGGTGCATAATGACATCAACATTGTAACTCTCCGATGCAGAGGTTAAATATAATTGGAGCTTATTTATTCATCTTCCAAAAAAGAAGTAGTAAACCCACCTGTTCGACAGACACAATTATCCTTTCCATCGATGTCGTTATAGCCAAATACTCCAACACTGTCGTATGCACTGATTAAATACCCGTGTCTGGGAAGGGCTTGGTGTGTTTGACTAAAACCAGGGCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU491232 True 238 lncRNA 0.40 1 69729555 69729792

Neighbor


gene id symbol gene type direction distance location
LOC110524450 k0841 coding downstream 1129 69715282 ~ 69728426 (-)
LOC110524449 LOC106613916 coding downstream 15225 69704871 ~ 69714330 (-)
LOC110524447 LOC106613914 coding downstream 110480 69551803 ~ 69619075 (-)
LOC110524442 LOC106613910 coding downstream 379004 69239531 ~ 69350551 (-)
si:dkey-21p1.3 LOC106613908 coding downstream 500886 69198487 ~ 69228669 (-)
LOC110524451 LOC106613917 coding upstream 8571 69738363 ~ 69743354 (-)
LOC110524454 rfc4 coding upstream 14794 69744586 ~ 69751448 (-)
LOC110524457 LOC106584309 coding upstream 95518 69825310 ~ 69834151 (-)
LOC110522884 LOC106604339 coding upstream 190365 69920157 ~ 69921094 (-)
LOC110524459 spata16 coding upstream 220412 69950204 ~ 70004717 (-)
G433735 NA non-coding downstream 26264 69656009 ~ 69703291 (-)
G433725 NA non-coding downstream 173064 69555019 ~ 69556491 (-)
G433683 LOC106613912 non-coding downstream 204765 69486406 ~ 69524790 (-)
G433697 NA non-coding downstream 224629 69502514 ~ 69504926 (-)
G433688 NA non-coding downstream 239797 69489450 ~ 69489758 (-)
G433818 NA non-coding upstream 3163 69732955 ~ 69733165 (-)
G433820 NA non-coding upstream 7152 69736944 ~ 69737409 (-)
G433889 NA non-coding upstream 137541 69867333 ~ 69886159 (-)
G433918 ect2 non-coding upstream 168137 69897929 ~ 69899326 (-)
G433938 NA non-coding upstream 194869 69924661 ~ 69924861 (-)
G432513 NA other downstream 723449 69004619 ~ 69006106 (-)
G432338 NA other downstream 974498 68748558 ~ 68755057 (-)
G432310 LOC106613894 other downstream 1022107 68699821 ~ 68707448 (-)
bend5 LOC106584333 other downstream 1376810 68331871 ~ 68352828 (-)
G435234 NA other upstream 1261100 70990892 ~ 70991798 (-)
G435176 NA other upstream 1338233 71068025 ~ 71068887 (-)
LOC110524478 LOC106613944 other upstream 1499390 71226012 ~ 71242283 (-)
il23r LOC106613945 other upstream 1556598 71285725 ~ 71308015 (-)
G436172 LOC100136696 other upstream 2311170 72040962 ~ 72121697 (-)

Expression


G433814 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G433814 Expression in each Bioproject

Bar chart with 10 bars.
G433814 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network