G441559



Basic Information


Item Value
gene id G441559
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 76968587 ~ 76968905 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU499779
CTTTAAAGGAAAAGGGGGTCTCATTAAAACTATATAGCCAAGAGACCAGCCTTCAAGTTTCTCCTCTATCATTAGCCAGAGTAACTGAAGATAACAGAACTTCAATTAGAGATTTGGATAACTCCATGTTGTCAATTTACTGCTGACAGAGCAGCATGATGTCTAACCTGGGACGGCCACCCTGTAGACCTCTTCACCTTCTATGTTTTAATGAGGGTTGCGACTGAGGAGAGCGTGACTCAATGACTCAAATAGGATGGTCATTGCTGAGATCTAGCCTATCTATCTCACCATCTAGCCTAGCCCTCTATGCTCCCCC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU499779 True 319 lncRNA 0.44 1 76968587 76968905

Neighbor


gene id symbol gene type direction distance location
LOC118964533 NA coding upstream 247455 76716999 ~ 76721132 (+)
LOC110524591 LOC106560304 coding upstream 264450 76693530 ~ 76704137 (+)
LOC110524592 LOC106560305 coding upstream 284552 76663864 ~ 76684035 (+)
LOC110524594 NA coding upstream 311689 76647620 ~ 76656898 (+)
LOC110524593 LOC106560306 coding upstream 329109 76609969 ~ 76639478 (+)
brdt brdt coding downstream 456771 77425676 ~ 77441632 (+)
LOC110524602 ephx4 coding downstream 475076 77443981 ~ 77455616 (+)
LOC110524603 LOC106560312 coding downstream 530236 77499141 ~ 77512420 (+)
LOC110524606 cssa10h1orf146 coding downstream 543819 77512724 ~ 77515120 (+)
LOC110524610 LOC106584167 coding downstream 653379 77622284 ~ 77627211 (+)
G441500 NA non-coding upstream 49061 76919322 ~ 76919526 (+)
G441494 NA non-coding upstream 58135 76910230 ~ 76910452 (+)
G441467 NA non-coding upstream 79811 76887782 ~ 76888776 (+)
G441466 NA non-coding upstream 82511 76885516 ~ 76886076 (+)
G441451 NA non-coding upstream 92638 76875730 ~ 76875949 (+)
G441578 NA non-coding downstream 10684 76979589 ~ 76979829 (+)
G441586 NA non-coding downstream 18214 76987119 ~ 76987378 (+)
G441600 NA non-coding downstream 27551 76996456 ~ 76997722 (+)
G441605 NA non-coding downstream 28833 76997738 ~ 76998049 (+)
G441606 NA non-coding downstream 30414 76999319 ~ 76999736 (+)
LOC110524571 LOC106560285 other upstream 1790300 75161317 ~ 75178287 (+)
G438719 NA other upstream 2192118 74772009 ~ 74776469 (+)
LOC110524560 LOC106560270 other upstream 2198421 74729349 ~ 74770168 (+)
G437327 NA other upstream 3473503 73456301 ~ 73495084 (+)
G436588 NA other upstream 3972852 72995499 ~ 72995735 (+)
G441903 NA other downstream 299307 77268212 ~ 77268766 (+)
G442273 NA other downstream 589425 77558330 ~ 77583227 (+)
LOC110524622 LOC106560333 other downstream 1276934 78245839 ~ 78288092 (+)
G445204 NA other downstream 3247573 80216478 ~ 80217090 (+)
G445211 NA other downstream 3265975 80234880 ~ 80235428 (+)

Expression


G441559 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G441559 Expression in each Bioproject

Bar chart with 6 bars.
G441559 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network