G446173



Basic Information


Item Value
gene id G446173
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 81391913 ~ 81392128 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU504862
ctcgatgacagcttttcacactcttggcattctctcaaccagcttcatgaggaatgcttttccaacagtcttgaaggagttcccacatatgctgagtgcttgttggctgcttttccttcaccctgcggtccaacttatcccaaaccatctcaattgagttgaggtagggtgattgtggagaccaggtcatctgaggccaggtcatctccatcactc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU504862 True 216 lncRNA 0.49 1 81391913 81392128
Loading

Neighbor


gene id symbol gene type direction distance location
gmds gmds coding upstream 161233 80974166 ~ 81230680 (+)
mylk4b LOC106560377 coding upstream 448375 80874015 ~ 80943538 (+)
LOC110524653 LOC100195912 coding upstream 562007 80827013 ~ 80829906 (+)
pycr3 pycrl coding upstream 565190 80818478 ~ 80826723 (+)
LOC110524651 LOC106560379 coding upstream 585378 80796999 ~ 80806535 (+)
LOC110524662 exoc2 coding downstream 25264 81417392 ~ 81575395 (+)
bphl bphl coding downstream 232878 81625006 ~ 81634179 (+)
LOC110524668 LOC106560365 coding downstream 388974 81781102 ~ 81825696 (+)
LOC110523016 LOC106560408 coding downstream 500698 81892826 ~ 81920506 (+)
LOC110523017 LOC105011947 coding downstream 540856 81932984 ~ 82130511 (+)
G446171 NA non-coding upstream 68 81391629 ~ 81391845 (+)
G446142 NA non-coding upstream 28725 81362988 ~ 81363188 (+)
G446133 NA non-coding upstream 36185 81355500 ~ 81355728 (+)
G446122 NA non-coding upstream 45792 81345895 ~ 81346121 (+)
G446111 NA non-coding upstream 53245 81337551 ~ 81338668 (+)
G446211 NA non-coding downstream 24709 81416837 ~ 81417043 (+)
G446205 NA non-coding downstream 245181 81637309 ~ 81642453 (+)
G446296 NA non-coding downstream 259474 81651602 ~ 81652625 (+)
G446303 NA non-coding downstream 298276 81690404 ~ 81690655 (+)
G446304 NA non-coding downstream 328240 81720368 ~ 81720849 (+)
G445211 NA other upstream 1156485 80234880 ~ 80235428 (+)
G445204 NA other upstream 1174823 80216478 ~ 80217090 (+)
LOC110524622 LOC106560333 other upstream 3133457 78245839 ~ 78288092 (+)
G442273 NA other upstream 3808686 77558330 ~ 77583227 (+)
G441903 NA other upstream 4123147 77268212 ~ 77268766 (+)
G446381 NA other downstream 503676 81895804 ~ 81897781 (+)
G447001 NA other downstream 1032070 82424198 ~ 82442223 (+)
G447020 NA other downstream 1060478 82452606 ~ 82458383 (+)
LOC110524684 NA other downstream 2396890 83788574 ~ 83794357 (+)
G448698 NA other downstream 2909972 84302100 ~ 84302473 (+)

Expression


G446173 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G446173 Expression in each Bioproject

Bar chart with 17 bars.
G446173 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network