G446999



Basic Information


Item Value
gene id G446999
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 82414847 ~ 82415211 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU505809
gtggtctctctatatatgcttgccaattgattcttcatgagatgcacctttgagcaatttagacaactggttgattgttggttgaactaacactttacattccttcatgagtgagggtcaatttcacctgcacgattcatcaattcaagtttttgtacaaaaggtctaatagaaatgtgtaaaactatgcttgacagtttatgacaaatagttcaacaattttgcatgtaatggcttatgcaaggaactaatgcctagatgttttgaggggtaagactattcaacagagaaccatctactatattttgatcaacatgacatgagcaattgataatgtggaaaaaagctgacacttgtacattatc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU505809 True 365 lncRNA 0.35 1 82414847 82415211
Loading

Neighbor


gene id symbol gene type direction distance location
igfbp1a LOC101268901 coding upstream 194351 82218472 ~ 82220496 (+)
LOC118936420 LOC106560395 coding upstream 265138 82141784 ~ 82149709 (+)
LOC118964728 LOC106560395 coding upstream 273347 82139830 ~ 82141500 (+)
LOC110523017 LOC105011947 coding upstream 284336 81932984 ~ 82130511 (+)
LOC110523016 LOC106560408 coding upstream 494341 81892826 ~ 81920506 (+)
LOC110523018 LOC106560398 coding downstream 126326 82541537 ~ 82600595 (+)
c5h8orf82 cssa10h8orf82 coding downstream 190945 82606156 ~ 82629774 (+)
naprt naprt coding downstream 217322 82632533 ~ 82660203 (+)
LOC110523019 LOC106560399 coding downstream 251984 82667195 ~ 82739466 (+)
rhpn1 rhpn1 coding downstream 332122 82747333 ~ 82775237 (+)
G446998 NA non-coding upstream 662 82413926 ~ 82414185 (+)
G446994 NA non-coding upstream 6853 82407754 ~ 82407994 (+)
G446987 NA non-coding upstream 20115 82394458 ~ 82394732 (+)
G446984 NA non-coding upstream 23779 82390417 ~ 82391068 (+)
G446973 NA non-coding upstream 53682 82360908 ~ 82361165 (+)
G447012 NA non-coding downstream 18006 82433217 ~ 82434524 (+)
G447020 NA non-coding downstream 37395 82452606 ~ 82458383 (+)
G447021 NA non-coding downstream 40599 82455810 ~ 82458156 (+)
G447036 NA non-coding downstream 55252 82470463 ~ 82482921 (+)
G447039 NA non-coding downstream 68448 82483659 ~ 82483911 (+)
G446381 NA other upstream 517066 81895804 ~ 81897781 (+)
G445211 NA other upstream 2179419 80234880 ~ 80235428 (+)
G445204 NA other upstream 2197757 80216478 ~ 80217090 (+)
LOC110524622 LOC106560333 other upstream 4156391 78245839 ~ 78288092 (+)
G442273 NA other upstream 4831620 77558330 ~ 77583227 (+)
G447001 NA other downstream 8987 82424198 ~ 82442223 (+)
LOC110524684 NA other downstream 1373807 83788574 ~ 83794357 (+)
G448698 NA other downstream 1886889 84302100 ~ 84302473 (+)
LOC118964674 NA other downstream 1972882 84386803 ~ 84389601 (+)

Expression


G446999 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G446999 Expression in each Bioproject

Bar chart with 19 bars.
G446999 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network