G447769



Basic Information


Item Value
gene id G447769
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 83363045 ~ 83370722 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU506746
acagtacatctcataaaacacatcacatctcataaaacacagcacatctcataaaacacagtacatgtcattaatttaaacacagcacatctcataaaacacagcacatctcacaaaacacagtacatgtcattaatttaaacacagcacatctcataaaacacagcacatctcataaaacacagtacatgtcattaatttaaacacagcacatctcataaaacacagcacatctcacaaaacacagtacatctcataaaacacatcacatctcataaaacacagcacatctcacaaaccaggcacatctcataaaacacagcatatctcataaaacacagtatatgtcacaaaaacacagtacatctcataaaacacatcacatctcataaaacacagcacatctcataaaacacagtacatgtcattaatttaaacacagcacatctcataaaacacatcacatctcataaaacacagtacatgtcattaatttaaacacagcacatctcataaaacaca

Function


NR:

description
PREDICTED: pupal cuticle protein-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU506746 True 522 lncRNA 0.33 2 83363045 83370722

Neighbor


gene id symbol gene type direction distance location
LOC118964671 adcyap1r1 coding upstream 115667 83237159 ~ 83252545 (+)
LOC110523020 LOC106560417 coding upstream 132492 83171501 ~ 83230553 (+)
cyldl LOC106560416 coding upstream 235081 83097156 ~ 83127964 (+)
rhpn1 rhpn1 coding upstream 587808 82747333 ~ 82775237 (+)
LOC110523019 LOC106560399 coding upstream 623579 82667195 ~ 82739466 (+)
LOC118964729 NA coding downstream 236013 83606735 ~ 83608575 (+)
LOC110523022 NA coding downstream 245714 83616436 ~ 83630276 (+)
LOC110524683 NA coding downstream 410969 83781691 ~ 83786833 (+)
LOC110524684 NA coding downstream 417852 83788574 ~ 83794357 (+)
gpx7 gpx7 coding downstream 467097 83837819 ~ 83850501 (+)
G447766 NA non-coding upstream 4450 83353940 ~ 83358595 (+)
G447765 NA non-coding upstream 9702 83347636 ~ 83353343 (+)
G447786 NA non-coding upstream 12140 83347257 ~ 83350905 (+)
G447740 NA non-coding upstream 125914 83236859 ~ 83237131 (+)
G447768 NA non-coding downstream 8993 83379715 ~ 83383573 (+)
G447770 NA non-coding downstream 12009 83382731 ~ 83386096 (+)
G448033 NA non-coding downstream 62135 83432857 ~ 83433265 (+)
G448039 NA non-coding downstream 87930 83458652 ~ 83458899 (+)
G448061 NA non-coding downstream 92260 83462982 ~ 83463259 (+)
G447020 NA other upstream 904662 82452606 ~ 82458383 (+)
G447001 NA other upstream 920822 82424198 ~ 82442223 (+)
G446381 NA other upstream 1465264 81895804 ~ 81897781 (+)
G445211 NA other upstream 3127617 80234880 ~ 80235428 (+)
G445204 NA other upstream 3145955 80216478 ~ 80217090 (+)
G448698 NA other downstream 931378 84302100 ~ 84302473 (+)
LOC118964674 NA other downstream 1017371 84386803 ~ 84389601 (+)
G449774 NA other downstream 1957850 85328572 ~ 85328942 (+)
G449809 NA other downstream 2075242 85445964 ~ 85447575 (+)

Expression


G447769 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G447769 Expression in each Bioproject

Bar chart with 9 bars.
G447769 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network