G450671



Basic Information


Item Value
gene id G450671
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 85337623 ~ 85337868 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU510072
GCTAAGACAATGTAACGTCCGCGAGTTAAATATTCTTAATATGATGGTCCTTTGATTAAACCTTACCTGATATTTCTGACATAATTTTCAACTCCTTGTTTGCACTTGGTCCAAAGGCAATTGTATTTACAATGGCACCACTTTCTTTAACCTCAGATGCACAATTTAATTCTGATTCCCCATCAGTTAAAAGGATGATTTCATCTCCCATTGTATTGCCATTGTCTTTGCGTAACTCCTGAAAAT

Function


NR:

description
PREDICTED: epithelial chloride channel protein-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU510072 True 246 lncRNA 0.36 1 85337623 85337868
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110524715 col24a1 coding downstream 162186 84934006 ~ 85175437 (-)
LOC118964676 NA coding downstream 235701 85100248 ~ 85101922 (-)
znhit6 znhit6 coding downstream 404501 84880003 ~ 84933122 (-)
ddah1 ddah1 coding downstream 475464 84709932 ~ 84862159 (-)
LOC110524711 cssa10h1orf52 coding downstream 639680 84693595 ~ 84697943 (-)
LOC118964733 NA coding upstream 97261 85435129 ~ 85443236 (-)
lurap1 LOC106560455 coding upstream 105628 85443496 ~ 85472422 (-)
LOC110524719 ttc4 coding upstream 165099 85502967 ~ 85511477 (-)
sgip1a sgip1 coding upstream 193822 85531690 ~ 85652797 (-)
pde4ba pde4b coding upstream 344441 85682309 ~ 86031149 (-)
G450643 LOC106560454 non-coding downstream 44979 85280534 ~ 85292644 (-)
G450640 LOC106560454 non-coding downstream 57092 85279324 ~ 85280531 (-)
G450528 NA non-coding downstream 284285 85051940 ~ 85053338 (-)
G450525 NA non-coding downstream 290127 85047246 ~ 85047496 (-)
G450494 NA non-coding downstream 364427 84972788 ~ 84973196 (-)
G450673 LOC106560414 non-coding upstream 972 85338840 ~ 85339159 (-)
G450677 NA non-coding upstream 5494 85343362 ~ 85343680 (-)
G450679 LOC106560414 non-coding upstream 6987 85344855 ~ 85410972 (-)
G450683 NA non-coding upstream 9065 85346933 ~ 85348199 (-)
G448452 NA other downstream 1420982 83916136 ~ 83916641 (-)
G448411 NA other downstream 1464315 83871602 ~ 83873308 (-)
G448079 NA other downstream 1817350 83510353 ~ 83520273 (-)
G447993 NA other downstream 2017908 83315161 ~ 83319715 (-)
G447220 NA other downstream 2946399 82390655 ~ 82391224 (-)
G450676 NA other upstream 4920 85342788 ~ 85343072 (-)
G450752 NA other upstream 148974 85486842 ~ 85487158 (-)
G450957 NA other upstream 539865 85877733 ~ 85878974 (-)
G451271 NA other upstream 1210970 86548838 ~ 86549878 (-)

Expression


G450671 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G450671 Expression in each Bioproject

Bar chart with 3 bars.
G450671 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network