G450676



Basic Information


Item Value
gene id G450676
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 85342788 ~ 85343072 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU510077
catggattaaaatcctgcagcgcacgcaaggtccccatgctcaagccagcgcatgtccaggcccgtctgaagtttgccaatgaccatctggatgatccagaggaggaatgggagaaggtcatgtggtctgatgagacaaaaatagagctttttggtaaaaactccactcgccgtgtatggcggaagaagaaggatgagtacaaccccaagaacaccatcccaaccgtgaagcatggaggtggaaacaccattctttggggatgcttttttgcaaaggggacagga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU510077 True 285 TUCP 0.50 1 85342788 85343072

Neighbor


gene id symbol gene type direction distance location
LOC110524715 col24a1 coding downstream 167351 84934006 ~ 85175437 (-)
LOC118964676 NA coding downstream 240866 85100248 ~ 85101922 (-)
znhit6 znhit6 coding downstream 409666 84880003 ~ 84933122 (-)
ddah1 ddah1 coding downstream 480629 84709932 ~ 84862159 (-)
LOC110524711 cssa10h1orf52 coding downstream 644845 84693595 ~ 84697943 (-)
LOC118964733 NA coding upstream 92057 85435129 ~ 85443236 (-)
lurap1 LOC106560455 coding upstream 100424 85443496 ~ 85472422 (-)
LOC110524719 ttc4 coding upstream 159895 85502967 ~ 85511477 (-)
sgip1a sgip1 coding upstream 188618 85531690 ~ 85652797 (-)
pde4ba pde4b coding upstream 339237 85682309 ~ 86031149 (-)
G450673 LOC106560414 non-coding downstream 3629 85338840 ~ 85339159 (-)
G450671 NA non-coding downstream 4920 85337623 ~ 85337868 (-)
G450643 LOC106560454 non-coding downstream 50144 85280534 ~ 85292644 (-)
G450640 LOC106560454 non-coding downstream 62257 85279324 ~ 85280531 (-)
G450528 NA non-coding downstream 289450 85051940 ~ 85053338 (-)
G450677 NA non-coding upstream 290 85343362 ~ 85343680 (-)
G450679 LOC106560414 non-coding upstream 1783 85344855 ~ 85410972 (-)
G450683 NA non-coding upstream 3861 85346933 ~ 85348199 (-)
G450767 NA non-coding upstream 182739 85525811 ~ 85527502 (-)
G448452 NA other downstream 1426147 83916136 ~ 83916641 (-)
G448411 NA other downstream 1469480 83871602 ~ 83873308 (-)
G448079 NA other downstream 1822515 83510353 ~ 83520273 (-)
G447993 NA other downstream 2023073 83315161 ~ 83319715 (-)
G447220 NA other downstream 2951564 82390655 ~ 82391224 (-)
G450752 NA other upstream 143770 85486842 ~ 85487158 (-)
G450957 NA other upstream 534661 85877733 ~ 85878974 (-)
G451271 NA other upstream 1205766 86548838 ~ 86549878 (-)
G451286 NA other upstream 1254280 86597352 ~ 86597744 (-)

Expression


G450676 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G450676 Expression in each Bioproject

Bar chart with 15 bars.
G450676 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network