G450752



Basic Information


Item Value
gene id G450752
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 85486842 ~ 85487158 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU510180
aattgatcgcccccatctagcttcagagttcgttctgttaggtgacctaaactgggatatgcttaacaccccggcagtcctacaatctaagctagatgccctcaatctcacacaaatcatcaaggaacccaccaggtacaaccctaaatccgtaaacatgggcaccatcatagacattatcctgatcaacttgccctccaaatacacctccgctgttttcaatccggatctcagcgatcactgcctcattgcctgtatccgctatgggtccgtggtcaaacaaccacccctcatcactgtcaaacgctccctaaacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU510180 True 317 TUCP 0.49 1 85486842 85487158
Loading

Neighbor


gene id symbol gene type direction distance location
lurap1 LOC106560455 coding downstream 14420 85443496 ~ 85472422 (-)
LOC118964733 NA coding downstream 43606 85435129 ~ 85443236 (-)
LOC110524715 col24a1 coding downstream 311405 84934006 ~ 85175437 (-)
LOC118964676 NA coding downstream 384920 85100248 ~ 85101922 (-)
znhit6 znhit6 coding downstream 553720 84880003 ~ 84933122 (-)
LOC110524719 ttc4 coding upstream 15809 85502967 ~ 85511477 (-)
sgip1a sgip1 coding upstream 44532 85531690 ~ 85652797 (-)
pde4ba pde4b coding upstream 195151 85682309 ~ 86031149 (-)
LOC118964679 NA coding upstream 584045 86071203 ~ 86071878 (-)
LOC110524724 lepr coding upstream 600035 86087193 ~ 86174451 (-)
G450679 LOC106560414 non-coding downstream 75870 85344855 ~ 85410972 (-)
G450683 NA non-coding downstream 138643 85346933 ~ 85348199 (-)
G450677 NA non-coding downstream 143162 85343362 ~ 85343680 (-)
G450673 LOC106560414 non-coding downstream 147683 85338840 ~ 85339159 (-)
G450767 NA non-coding upstream 38653 85525811 ~ 85527502 (-)
G450790 NA non-coding upstream 95608 85582766 ~ 85612910 (-)
G450801 NA non-coding upstream 128822 85615980 ~ 85619096 (-)
G450818 NA non-coding upstream 155678 85642836 ~ 85643526 (-)
G450825 NA non-coding upstream 168376 85655534 ~ 85655803 (-)
G450676 NA other downstream 143770 85342788 ~ 85343072 (-)
G448452 NA other downstream 1570201 83916136 ~ 83916641 (-)
G448411 NA other downstream 1613534 83871602 ~ 83873308 (-)
G448079 NA other downstream 1966569 83510353 ~ 83520273 (-)
G450957 NA other upstream 390575 85877733 ~ 85878974 (-)
G451271 NA other upstream 1061680 86548838 ~ 86549878 (-)
G451286 NA other upstream 1110194 86597352 ~ 86597744 (-)
ror1 LOC106560470 other upstream 1278425 86763372 ~ 87043134 (-)
G451856 NA other upstream 1754696 87241854 ~ 87243233 (-)

Expression


G450752 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G450752 Expression in each Bioproject

Bar chart with 20 bars.
G450752 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network