G450801



Basic Information


Item Value
gene id G450801
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 85615980 ~ 85619096 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU510239
gtgttttccttgttttagtgttggtcaggacgtgaactgggtgggcattctatgttggatgtcttgtttgtctatttctatgtctggcctgatatggttctcaatcagaggcaggtgttagtcattgtctctgattgggaaccatatttaggtagcctgggtttcactgtgtgtttgtgggtgattgttcctgtccttagtgtcctgatgtcattggtctgtgttaggttacacaagtataggctgttttggttttcgttaagtttattgttttgatagtgtttgtgtttagtgtgttacttcattaaacatggat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU510239 True 316 lncRNA 0.40 2 85615980 85619096

Neighbor


gene id symbol gene type direction distance location
LOC110524719 ttc4 coding downstream 104503 85502967 ~ 85511477 (-)
lurap1 LOC106560455 coding downstream 143558 85443496 ~ 85472422 (-)
LOC118964733 NA coding downstream 172744 85435129 ~ 85443236 (-)
LOC110524715 col24a1 coding downstream 440543 84934006 ~ 85175437 (-)
pde4ba pde4b coding upstream 63213 85682309 ~ 86031149 (-)
LOC118964679 NA coding upstream 452107 86071203 ~ 86071878 (-)
LOC110524724 lepr coding upstream 468097 86087193 ~ 86174451 (-)
LOC110524725 dnajc6 coding upstream 568291 86187387 ~ 86248090 (-)
ak4 ak4 coding upstream 634408 86253504 ~ 86260188 (-)
G450790 NA non-coding downstream 3070 85582766 ~ 85612910 (-)
G450767 NA non-coding downstream 88478 85525811 ~ 85527502 (-)
G450679 LOC106560414 non-coding downstream 205008 85344855 ~ 85410972 (-)
G450683 NA non-coding downstream 267781 85346933 ~ 85348199 (-)
G450818 NA non-coding upstream 23740 85642836 ~ 85643526 (-)
G450825 NA non-coding upstream 36438 85655534 ~ 85655803 (-)
G450837 LOC100194703 non-coding upstream 52828 85671924 ~ 85672425 (-)
G450845 NA non-coding upstream 69941 85689037 ~ 85689249 (-)
G450870 NA non-coding upstream 122372 85741468 ~ 85741761 (-)
G450752 NA other downstream 128822 85486842 ~ 85487158 (-)
G450676 NA other downstream 272908 85342788 ~ 85343072 (-)
G448452 NA other downstream 1699339 83916136 ~ 83916641 (-)
G448411 NA other downstream 1742672 83871602 ~ 83873308 (-)
G450957 NA other upstream 258637 85877733 ~ 85878974 (-)
G451271 NA other upstream 929742 86548838 ~ 86549878 (-)
G451286 NA other upstream 978256 86597352 ~ 86597744 (-)
ror1 LOC106560470 other upstream 1146487 86763372 ~ 87043134 (-)
G451856 NA other upstream 1622758 87241854 ~ 87243233 (-)

Expression


G450801 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G450801 Expression in each Bioproject

Bar chart with 18 bars.
G450801 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network