G451271



Basic Information


Item Value
gene id G451271
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 86548838 ~ 86549878 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU510750
gccacatttcaggcttcaaacataaagatataaaactgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaagttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacatgtgtgtaatcaagtctccgtataaatgcacctgcaccgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagacactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctgtccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggtccatgatcactctggatgaactgcagagatctacagctgaggtggaagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagaaatccataaaaagtgttggttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaatgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggac

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU510750 True 1041 TUCP 0.42 1 86548838 86549878

Neighbor


gene id symbol gene type direction distance location
raver2 raver2 coding downstream 1626 86351342 ~ 86547212 (-)
ak4 ak4 coding downstream 288650 86253504 ~ 86260188 (-)
LOC110524725 dnajc6 coding downstream 300748 86187387 ~ 86248090 (-)
LOC110524724 lepr coding downstream 374387 86087193 ~ 86174451 (-)
LOC118964679 NA coding downstream 476960 86071203 ~ 86071878 (-)
cachd1 cachd1 coding upstream 6852 86556176 ~ 86712442 (-)
ror1 LOC106560470 coding upstream 213494 86763372 ~ 87043134 (-)
pgm1 LOC106560477 coding upstream 505156 87055034 ~ 87067699 (-)
efcab7 efcab7 coding upstream 521953 87071831 ~ 87093894 (-)
alg6 alg6 coding upstream 558122 87108000 ~ 87144341 (-)
G451266 NA non-coding downstream 10254 86538142 ~ 86538584 (-)
G451261 NA non-coding downstream 15617 86532848 ~ 86533221 (-)
G451260 NA non-coding downstream 16977 86531573 ~ 86531861 (-)
G451256 NA non-coding downstream 24561 86524026 ~ 86524277 (-)
G451253 NA non-coding downstream 29193 86519320 ~ 86519645 (-)
G451273 NA non-coding upstream 2965 86552843 ~ 86553228 (-)
G451240 NA non-coding upstream 4587 86554465 ~ 86554798 (-)
G451241 NA non-coding upstream 5035 86554913 ~ 86556046 (-)
G451281 NA non-coding upstream 30009 86579887 ~ 86580526 (-)
G450957 NA other downstream 669864 85877733 ~ 85878974 (-)
G450752 NA other downstream 1061680 85486842 ~ 85487158 (-)
lurap1 LOC106560455 other downstream 1076958 85443496 ~ 85472422 (-)
G450676 NA other downstream 1205766 85342788 ~ 85343072 (-)
G448452 NA other downstream 2632197 83916136 ~ 83916641 (-)
G451286 NA other upstream 47474 86597352 ~ 86597744 (-)
G451856 NA other upstream 691976 87241854 ~ 87243233 (-)
G452255 NA other upstream 948488 87498366 ~ 87499136 (-)
LOC110523029 LOC106584023 other upstream 1224344 87685213 ~ 88049103 (-)

Expression


G451271 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G451271 Expression in each Bioproject

Bar chart with 21 bars.
G451271 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network