G450398


Basic Information

Item Value
gene id G450398
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 86601052 ~ 86601506 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU509779
GACAAGACATTCACATAGGAGTTGTTGTCCTCGAGGAGAGTGCTGGGTTAGGATAAGTGTGGAGGTGTAGGACACACCTTTGTTGTCTATGAGGAAGGTGTAGGAGGCCAAGGAATCCTGGTAGTAGGTGACGTCCTCTAGAATGTAGGCTAGGTTCACGTCCACCCCAACCACACCCAGCAACAGGTTGCCAAAGTAACAGGGCCGGCTCACCGTCATGATGAAACCTGCAGGGAGAGGACAGATAGTTTTACATGACACTGATTGATCACCAAGAGCCCAAATCAATCTGATCCAGTTAATAATATTTTCTTTACCACTGATTTAGGTTTAGCAGTGTACATTAGTTCTAACCTTAAACGTGATGTGGACATAAG

Function

NR:

description
PREDICTED: VWFA and cache domain-containing protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU509779 True 377 lncRNA 0.46 2 86601052 86601506

Neighbor

gene id symbol gene type direction distance location
LOC118964680 NA coding upstream 232112 86364739 ~ 86368940 (+)
jak1 jak1 coding upstream 257668 86264428 ~ 86343384 (+)
LOC110524728 NA coding upstream 338900 86259980 ~ 86262152 (+)
LOC118964753 NA coding upstream 375107 86225891 ~ 86225945 (+)
LOC118964678 NA coding upstream 942144 85656730 ~ 85659355 (+)
si:dkey-148h10.5 LOC106560479 coding downstream 492528 87094034 ~ 87107836 (+)
dock7 LOC106560483 coding downstream 800264 87401770 ~ 87493654 (+)
kank4 kank4 coding downstream 920199 87520224 ~ 87666404 (+)
dmrt2b LOC106560523 coding downstream 1570253 88171759 ~ 88177340 (+)
fam183a LOC106560522 coding downstream 1659930 88261436 ~ 88263514 (+)
G450391 NA non-coding upstream 8969 86591671 ~ 86592083 (+)
G450390 NA non-coding upstream 10433 86590329 ~ 86590619 (+)
G450389 NA non-coding upstream 10923 86589790 ~ 86590129 (+)
G450387 cachd1 non-coding upstream 16064 86584736 ~ 86584988 (+)
G450377 NA non-coding upstream 25454 86569219 ~ 86575598 (+)
G450399 cachd1 non-coding downstream 222 86601728 ~ 86602040 (+)
G450415 NA non-coding downstream 32091 86633597 ~ 86634739 (+)
G450416 NA non-coding downstream 33409 86634915 ~ 86635701 (+)
G450417 NA non-coding downstream 34251 86635757 ~ 86636013 (+)
G450418 NA non-coding downstream 34817 86636323 ~ 86636623 (+)
G450394 NA other upstream 4537 86596147 ~ 86596515 (+)
G450331 NA other upstream 45005 86554473 ~ 86558452 (+)
G450333 NA other upstream 132115 86468538 ~ 86468937 (+)
G449809 NA other upstream 1153477 85445964 ~ 85447575 (+)
G449774 NA other upstream 1272110 85328572 ~ 85328942 (+)
G451408 LOC106584030 other downstream 242370 86843876 ~ 86844271 (+)
G451959 LOC106584028 other downstream 819298 87420804 ~ 87422836 (+)
G452064 NA other downstream 1016626 87618132 ~ 87620643 (+)

Expression


Co-expression Network