G451320



Basic Information


Item Value
gene id G451320
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 86712690 ~ 86712938 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU510799
GTGCTGTTGTAGCATATGGTTAGGATAATCACTTGGCCTATGTTTTAAAGCAAAATGTGATTTTTCATTATCACCATTGTTGAAAGAAAGTGCTTTACATTATGTGATTTCTATTTGCTTGATGAAATGTAATAACTGCAATCCCCAGTGTTTGTTGACTATATAAAATACTAGGCATATGTTGCTTTAGCTGATGTAGCCTATAGTAGCTATTTACAGAGCGTCTGTTGAGCATATTGTTTTACAGTA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU510799 True 249 lncRNA 0.33 1 86712690 86712938

Neighbor


gene id symbol gene type direction distance location
cachd1 cachd1 coding downstream 248 86556176 ~ 86712442 (-)
raver2 raver2 coding downstream 165478 86351342 ~ 86547212 (-)
ak4 ak4 coding downstream 452502 86253504 ~ 86260188 (-)
LOC110524725 dnajc6 coding downstream 464600 86187387 ~ 86248090 (-)
LOC110524724 lepr coding downstream 538239 86087193 ~ 86174451 (-)
ror1 LOC106560470 coding upstream 50434 86763372 ~ 87043134 (-)
pgm1 LOC106560477 coding upstream 342096 87055034 ~ 87067699 (-)
efcab7 efcab7 coding upstream 358893 87071831 ~ 87093894 (-)
alg6 alg6 coding upstream 395062 87108000 ~ 87144341 (-)
foxd3 foxd3 coding upstream 438887 87151825 ~ 87153819 (-)
G451317 NA non-coding downstream 2148 86709780 ~ 86710542 (-)
G451309 NA non-coding downstream 20924 86691498 ~ 86691766 (-)
G451299 NA non-coding downstream 55601 86656885 ~ 86657089 (-)
G451297 NA non-coding downstream 65345 86644200 ~ 86647345 (-)
G451291 NA non-coding downstream 99317 86612924 ~ 86613373 (-)
G451324 LOC106586115 non-coding upstream 5025 86717963 ~ 86718212 (-)
G451330 NA non-coding upstream 9333 86722271 ~ 86722521 (-)
G451345 NA non-coding upstream 23912 86736850 ~ 86738039 (-)
G451353 NA non-coding upstream 35854 86748792 ~ 86749083 (-)
G451357 NA non-coding upstream 38289 86751227 ~ 86751568 (-)
G451286 NA other downstream 114946 86597352 ~ 86597744 (-)
G451271 NA other downstream 162812 86548838 ~ 86549878 (-)
G450957 NA other downstream 833716 85877733 ~ 85878974 (-)
G450752 NA other downstream 1225532 85486842 ~ 85487158 (-)
lurap1 LOC106560455 other downstream 1240810 85443496 ~ 85472422 (-)
G451856 NA other upstream 528916 87241854 ~ 87243233 (-)
G452255 NA other upstream 785428 87498366 ~ 87499136 (-)
LOC110523029 LOC106584023 other upstream 1061284 87685213 ~ 88049103 (-)
G452442 NA other upstream 1147189 87860127 ~ 87866464 (-)

Expression


G451320 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G451320 Expression in each Bioproject

Bar chart with 3 bars.
G451320 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network