XLOC_023641


Basic Information

Item Value
gene id XLOC_023641
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007135.7
NCBI id CM002908.2
chromosome length 42172926
location 37289468 ~ 37295101 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00047255
CGAAAACGCGCTGAAGTATGGATTAGTAGCAGGAATGAACAGCACAGCCTGAGAGTGGATTCACTGTGTAGTGTCTGAAAAAACAAAAGTGCGGGGTGTTTCTGCTCTCCGTCAGTGCAGTGTGTTTCCCGTCACCCACTTCAGCGGAGCTCCGAGCACAGGATGGCGGAGACTCACGGCGGGATCTGCGGGCAGGAGTCCCGGCGAGCGGCTCCGGTTCAGACCTTTAACCACCGCTCCTCCAAATGGGTCCGTCTAAACGTCGGGGGAACGTATTTTCTGACCACCAGACAAACACTCTGCCGGGACCCAAAATCATTCCTGTTCCGACTGTGCCAAACGGAACCGGACCTCGATTCTGACAAGCGCAGATGAGCGTCAGCATGGCATTGTTTGGTTCTCCTGCAGCTCGGGCCGTCTCACCTCCTCTCATCTCTCAA

Function

GO:

id name namespace
GO:0048731 system development biological_process
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0010628 positive regulation of gene expression biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0030154 cell differentiation biological_process
GO:0048513 animal organ development biological_process
GO:0007275 multicellular organism development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0009891 positive regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0031328 positive regulation of cellular biosynthetic process biological_process
GO:1902680 positive regulation of RNA biosynthetic process biological_process
GO:0048856 anatomical structure development biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0051254 positive regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:1903508 positive regulation of nucleic acid-templated transcription biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0048869 cellular developmental process biological_process
GO:0045893 positive regulation of transcription, DNA-templated biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0032501 multicellular organismal process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032502 developmental process biological_process
GO:0045935 positive regulation of nucleobase-containing compound metabolic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0010557 positive regulation of macromolecule biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0043292 contractile fiber cellular_component
GO:0044449 obsolete contractile fiber part cellular_component
GO:0005634 nucleus cellular_component
GO:0030016 myofibril cellular_component
GO:0030017 sarcomere cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0001228 DNA-binding transcription activator activity, RNA polymerase II-specific molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:0140110 transcription regulator activity molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00047255 True 440 lncRNA 0.56 2 37289468 37295101

Neighbor

gene id symbol gene type direction distance location
XLOC_023640 CABZ01055522.1 coding downstream 1676 37274759 ~ 37287792 (-)
XLOC_023639 ube2ib coding downstream 17352 37257596 ~ 37272116 (-)
XLOC_023638 cog7 coding downstream 63591 37195463 ~ 37225877 (-)
XLOC_023637 NA coding downstream 118544 37170317 ~ 37170924 (-)
XLOC_023636 NA coding downstream 212651 37069683 ~ 37076817 (-)
XLOC_023642 pdpk1b coding upstream 6751 37301852 ~ 37326236 (-)
XLOC_023643 tsr3 coding upstream 34018 37329119 ~ 37338739 (-)
XLOC_023644 CU469584.1 coding upstream 66088 37361189 ~ 37404466 (-)
XLOC_023645 cluap1 coding upstream 171669 37466770 ~ 37484123 (-)
XLOC_023646 h1-0 coding upstream 271928 37567029 ~ 37568359 (-)
XLOC_023665 dre-mir-735 misc upstream 882860 38177961 ~ 38178027 (-)
XLOC_023635 NA non-coding downstream 239557 37046594 ~ 37049911 (-)
XLOC_023632 NA non-coding downstream 410341 36872875 ~ 36879127 (-)
XLOC_023628 NA non-coding downstream 590461 36689295 ~ 36699007 (-)
XLOC_023651 NA non-coding upstream 410525 37705626 ~ 37708051 (-)
XLOC_023652 NA non-coding upstream 429873 37724974 ~ 37726949 (-)
XLOC_023658 BX001030.2 non-coding upstream 790216 38085317 ~ 38092588 (-)
XLOC_023660 BX001030.1 non-coding upstream 803795 38098896 ~ 38099675 (-)

Expression


Co-expression Network