G451677



Basic Information


Item Value
gene id G451677
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 86999152 ~ 87002397 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU511182
tgtccgaataatagtagagatttatttcagcttttatttctttcatcacattcccagtgggtcagaagtttacatacactcaattagtatttggtgcgttgcctttaaattgtttaatttgggtcaaacgtttcaggtagccttccacaagattcccacaataatttgggtgaattttggcccattccacatgacagagctggtgtaactgagtgaggtttgtaggcctccttgcttgcacaatctt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU511182 True 247 lncRNA 0.39 2 86999152 87002397

Neighbor


gene id symbol gene type direction distance location
cachd1 cachd1 coding downstream 286710 86556176 ~ 86712442 (-)
raver2 raver2 coding downstream 451940 86351342 ~ 86547212 (-)
ak4 ak4 coding downstream 738964 86253504 ~ 86260188 (-)
LOC110524725 dnajc6 coding downstream 751062 86187387 ~ 86248090 (-)
LOC110524724 lepr coding downstream 824701 86087193 ~ 86174451 (-)
pgm1 LOC106560477 coding upstream 52637 87055034 ~ 87067699 (-)
efcab7 efcab7 coding upstream 69434 87071831 ~ 87093894 (-)
alg6 alg6 coding upstream 105603 87108000 ~ 87144341 (-)
foxd3 foxd3 coding upstream 149428 87151825 ~ 87153819 (-)
atg4c atg4c coding upstream 389264 87391661 ~ 87401413 (-)
G451662 NA non-coding downstream 22606 86975159 ~ 86976546 (-)
G451656 NA non-coding downstream 32631 86962194 ~ 86966521 (-)
G451657 NA non-coding downstream 33072 86962461 ~ 86966080 (-)
G451618 NA non-coding downstream 113707 86884076 ~ 86885445 (-)
G451607 NA non-coding downstream 139420 86859530 ~ 86859732 (-)
G451706 NA non-coding upstream 38422 87040819 ~ 87095013 (-)
G451740 NA non-coding upstream 128620 87131017 ~ 87133651 (-)
G451742 NA non-coding upstream 136050 87138447 ~ 87140841 (-)
G451743 NA non-coding upstream 136198 87138595 ~ 87142676 (-)
ror1 LOC106560470 other downstream 233165 86763372 ~ 87043134 (-)
G451286 NA other downstream 401408 86597352 ~ 86597744 (-)
G451271 NA other downstream 449274 86548838 ~ 86549878 (-)
G450957 NA other downstream 1120178 85877733 ~ 85878974 (-)
G450752 NA other downstream 1511994 85486842 ~ 85487158 (-)
G451856 NA other upstream 239457 87241854 ~ 87243233 (-)
G452255 NA other upstream 495969 87498366 ~ 87499136 (-)
LOC110523029 LOC106584023 other upstream 771825 87685213 ~ 88049103 (-)
G452442 NA other upstream 857730 87860127 ~ 87866464 (-)
G452457 NA other upstream 892335 87894732 ~ 87895212 (-)

Expression


G451677 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G451677 Expression in each Bioproject

Bar chart with 16 bars.
G451677 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network