G451743



Basic Information


Item Value
gene id G451743
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 87138595 ~ 87142676 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU511255
caggttaaataacagtacacatcaacactactgaaatacagatttaagaacagtacacatcaacactactgaaatacaggtttaagaacagtaaacatcaacactactgaaatacaggtttaagaacagtaaacatcaacactactgaaatacaggtttaagaacagtaaacatcaacactactgacagacaggttaaagaacagtacacatcaacactactgacagacaggttaaagaacagtacacatcaacactactgaaatacagatttaagaacagta
>TU511254
catcaacactactgaaatacagatttaagaacagtaaacatcaacactactgacagacaggttaaataacagtacacatcaacactactgacagacaggtttaagaacagtaaacatcaacactactgacagacaggttaaagaacagtaaacatcaacactactgacatacagatttaagaacagtaaacatcaacactactgaaatacaggttaaataacagtaaacatcaa

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU511255 False 283 lncRNA 0.34 2 87138595 87142509
TU511254 True 234 lncRNA 0.33 2 87142219 87142676
Loading

Neighbor


gene id symbol gene type direction distance location
efcab7 efcab7 coding downstream 44701 87071831 ~ 87093894 (-)
pgm1 LOC106560477 coding downstream 70896 87055034 ~ 87067699 (-)
ror1 LOC106560470 coding downstream 95461 86763372 ~ 87043134 (-)
cachd1 cachd1 coding downstream 426153 86556176 ~ 86712442 (-)
raver2 raver2 coding downstream 591383 86351342 ~ 86547212 (-)
foxd3 foxd3 coding upstream 9149 87151825 ~ 87153819 (-)
atg4c atg4c coding upstream 248985 87391661 ~ 87401413 (-)
angptl3 LOC106584028 coding upstream 276554 87419230 ~ 87424068 (-)
usp1 usp1 coding upstream 363073 87505749 ~ 87520050 (-)
LOC110522895 NA coding upstream 515253 87657929 ~ 87659520 (-)
G451740 NA non-coding downstream 4944 87131017 ~ 87133651 (-)
G451706 NA non-coding downstream 43582 87040819 ~ 87095013 (-)
G451677 NA non-coding downstream 136198 86999152 ~ 87002397 (-)
G451662 NA non-coding downstream 162049 86975159 ~ 86976546 (-)
G451860 NA non-coding upstream 105929 87248605 ~ 87248829 (-)
G451863 NA non-coding upstream 125271 87267947 ~ 87268208 (-)
G451890 NA non-coding upstream 154180 87296856 ~ 87299127 (-)
G451935 NA non-coding upstream 240210 87382886 ~ 87383098 (-)
G451936 NA non-coding upstream 240578 87383254 ~ 87383483 (-)
G451286 NA other downstream 540851 86597352 ~ 86597744 (-)
G451271 NA other downstream 588717 86548838 ~ 86549878 (-)
G450957 NA other downstream 1259621 85877733 ~ 85878974 (-)
G450752 NA other downstream 1651437 85486842 ~ 85487158 (-)
G451856 NA other upstream 99178 87241854 ~ 87243233 (-)
G452255 NA other upstream 355690 87498366 ~ 87499136 (-)
LOC110523029 LOC106584023 other upstream 631546 87685213 ~ 88049103 (-)
G452442 NA other upstream 717451 87860127 ~ 87866464 (-)
G452457 NA other upstream 752056 87894732 ~ 87895212 (-)

Expression


G451743 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G451743 Expression in each Bioproject

Bar chart with 16 bars.
G451743 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network