G451936



Basic Information


Item Value
gene id G451936
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 87383254 ~ 87383483 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU511504
ggaacaagctgcctcaaacactcaaactgcacagttttatctcaatctcttaattcaaagactcaatcatggacactcttactgacagttgtgactgctttgtgtgatgtattgttgtctctaccttcttgaacgttgtgctgttgactgtgcccaataatgtttgtgccatgttttgtgctgctaccatgctgtggtgctaccatgttgttgttatgttgtgttgctac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU511504 True 230 lncRNA 0.42 1 87383254 87383483
Loading

Neighbor


gene id symbol gene type direction distance location
foxd3 foxd3 coding downstream 229435 87151825 ~ 87153819 (-)
alg6 alg6 coding downstream 238913 87108000 ~ 87144341 (-)
efcab7 efcab7 coding downstream 289360 87071831 ~ 87093894 (-)
pgm1 LOC106560477 coding downstream 315555 87055034 ~ 87067699 (-)
ror1 LOC106560470 coding downstream 340120 86763372 ~ 87043134 (-)
atg4c atg4c coding upstream 8178 87391661 ~ 87401413 (-)
angptl3 LOC106584028 coding upstream 35747 87419230 ~ 87424068 (-)
usp1 usp1 coding upstream 122266 87505749 ~ 87520050 (-)
LOC110522895 NA coding upstream 274446 87657929 ~ 87659520 (-)
LOC110523029 LOC106584023 coding upstream 301730 87685213 ~ 88049103 (-)
G451935 NA non-coding downstream 156 87382886 ~ 87383098 (-)
G451890 NA non-coding downstream 84127 87296856 ~ 87299127 (-)
G451863 NA non-coding downstream 115046 87267947 ~ 87268208 (-)
G451860 NA non-coding downstream 134425 87248605 ~ 87248829 (-)
G451743 NA non-coding downstream 240578 87138595 ~ 87142676 (-)
G451940 NA non-coding upstream 4786 87388269 ~ 87388539 (-)
G452274 NA non-coding upstream 83421 87466904 ~ 87467595 (-)
G452248 NA non-coding upstream 109653 87493136 ~ 87493960 (-)
G452330 NA non-coding upstream 200708 87584191 ~ 87666309 (-)
G452348 NA non-coding upstream 243770 87627253 ~ 87690633 (-)
G451856 NA other downstream 140021 87241854 ~ 87243233 (-)
G451286 NA other downstream 785510 86597352 ~ 86597744 (-)
G451271 NA other downstream 833376 86548838 ~ 86549878 (-)
G450957 NA other downstream 1504280 85877733 ~ 85878974 (-)
G452255 NA other upstream 114883 87498366 ~ 87499136 (-)
G452442 NA other upstream 476644 87860127 ~ 87866464 (-)
G452457 NA other upstream 511249 87894732 ~ 87895212 (-)
G452504 NA other upstream 600477 87983960 ~ 87984633 (-)

Expression


G451936 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G451936 Expression in each Bioproject

Bar chart with 18 bars.
G451936 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network