G452381



Basic Information


Item Value
gene id G452381
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 87722617 ~ 87722825 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU512078
ggtttaagtctttttgtgggatgtttttgtatagattttcaaagtaagttttccaaattcctacatcttgtatggctaattcttgtggctttgatgtgcttaaattgttccacatgtcccagaactgattttggtcaattgcgttttcaatttcatcaagtgtcttgttggtataattcaatttcttgcatttcagtgtttgtttatac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU512078 True 209 lncRNA 0.33 1 87722617 87722825
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110522895 NA coding downstream 63097 87657929 ~ 87659520 (-)
usp1 usp1 coding downstream 202567 87505749 ~ 87520050 (-)
angptl3 LOC106584028 coding downstream 298549 87419230 ~ 87424068 (-)
atg4c atg4c coding downstream 321204 87391661 ~ 87401413 (-)
foxd3 foxd3 coding downstream 568798 87151825 ~ 87153819 (-)
LOC110524751 LOC106560521 coding upstream 539750 88262575 ~ 88268140 (-)
ap1m3 LOC106560519 coding upstream 583103 88305928 ~ 88348088 (-)
c5h1orf210 LOC106560518 coding upstream 625508 88348333 ~ 88355068 (-)
orc1 orc1 coding upstream 679105 88401930 ~ 88412796 (-)
LOC110524758 LOC106560512 coding upstream 694592 88417417 ~ 88419175 (-)
G452380 NA non-coding downstream 10577 87711738 ~ 87712040 (-)
G452379 NA non-coding downstream 12719 87709628 ~ 87709898 (-)
G452376 NA non-coding downstream 15683 87706649 ~ 87706934 (-)
G452375 NA non-coding downstream 16131 87706277 ~ 87706486 (-)
G452370 NA non-coding downstream 30274 87692083 ~ 87692343 (-)
G452382 NA non-coding upstream 7648 87730473 ~ 87731092 (-)
G452386 NA non-coding upstream 19446 87742271 ~ 87742471 (-)
G452387 NA non-coding upstream 20639 87743464 ~ 87743737 (-)
G452390 NA non-coding upstream 31015 87753840 ~ 87754060 (-)
G452391 NA non-coding upstream 38657 87761482 ~ 87761783 (-)
G452255 NA other downstream 223481 87498366 ~ 87499136 (-)
G451856 NA other downstream 479384 87241854 ~ 87243233 (-)
ror1 LOC106560470 other downstream 956630 86763372 ~ 87043134 (-)
G451286 NA other downstream 1124873 86597352 ~ 86597744 (-)
G451271 NA other downstream 1172739 86548838 ~ 86549878 (-)
LOC110523029 LOC106584023 other upstream 51397 87685213 ~ 88049103 (-)
G452442 NA other upstream 137302 87860127 ~ 87866464 (-)
G452457 NA other upstream 171907 87894732 ~ 87895212 (-)
G452504 NA other upstream 261135 87983960 ~ 87984633 (-)
G452517 NA other upstream 283094 88005919 ~ 88006587 (-)

Expression


G452381 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G452381 Expression in each Bioproject

Bar chart with 14 bars.
G452381 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 500.
End of interactive chart.

Co-expression Network