G452504



Basic Information


Item Value
gene id G452504
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 87983960 ~ 87984633 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU512205
tagtcacggttttgtctcaccaggagtgatggtcggattcacgtttatcgtcgaaggaatgagcgttacaccgaggcctgtactctggagtgggatcgatttggaggtggagggtccgtcacggtctggggctgtgtgtcacagcagcatcggactgagcttgttgtcattgtaggcaatctcaacgctgtgcgttacagggaagacatcctcctccctcatgtggtacccttcctgcaggctcatcctgacatgaccctccaggatgacaatgccaccagccatactactcgttctgtgcgtgatttcctgcaagacaggaatgttagtgttctgccatggccagcgaagagcccagatctcaatcccattgaacacgtctgggacctgttggatcggagggtgagggctagggccattccccccagaaatgtccgggaacttgcaggtgccttggtggaagagtggggtaacatctcacagcaagaacaggcaaatctggtgcagttcatgaggaggagatgcactgcagtacttaatgcagctggtggccacaccagatactgactgttacttttgattttgacacattatttaatttctgttagtcacctgtctgtggaacttgttcagtttatatctcagttgttgaatcttgttatgtccatacaaat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU512205 True 674 TUCP 0.50 1 87983960 87984633

Neighbor


gene id symbol gene type direction distance location
LOC110522895 NA coding downstream 324440 87657929 ~ 87659520 (-)
usp1 usp1 coding downstream 463910 87505749 ~ 87520050 (-)
angptl3 LOC106584028 coding downstream 559892 87419230 ~ 87424068 (-)
atg4c atg4c coding downstream 582547 87391661 ~ 87401413 (-)
foxd3 foxd3 coding downstream 830141 87151825 ~ 87153819 (-)
LOC110524751 LOC106560521 coding upstream 277942 88262575 ~ 88268140 (-)
ap1m3 LOC106560519 coding upstream 321295 88305928 ~ 88348088 (-)
c5h1orf210 LOC106560518 coding upstream 363700 88348333 ~ 88355068 (-)
orc1 orc1 coding upstream 417297 88401930 ~ 88412796 (-)
LOC110524758 LOC106560512 coding upstream 432784 88417417 ~ 88419175 (-)
G452503 NA non-coding downstream 130 87983583 ~ 87983830 (-)
G452502 NA non-coding downstream 660 87982968 ~ 87983300 (-)
G452497 NA non-coding downstream 10198 87973228 ~ 87973762 (-)
G452493 NA non-coding downstream 14173 87969560 ~ 87969787 (-)
G452492 NA non-coding downstream 15486 87968246 ~ 87968474 (-)
G452511 NA non-coding upstream 11939 87996572 ~ 87996791 (-)
G452522 NA non-coding upstream 29135 88013768 ~ 88014021 (-)
G452523 NA non-coding upstream 30333 88014966 ~ 88015190 (-)
G452524 NA non-coding upstream 30866 88015499 ~ 88015841 (-)
G452525 NA non-coding upstream 31456 88016089 ~ 88016374 (-)
G452457 NA other downstream 88748 87894732 ~ 87895212 (-)
G452442 NA other downstream 117496 87860127 ~ 87866464 (-)
LOC110523029 LOC106584023 other downstream 178095 87685213 ~ 88049103 (-)
G452255 NA other downstream 484824 87498366 ~ 87499136 (-)
G451856 NA other downstream 740727 87241854 ~ 87243233 (-)
G452517 NA other upstream 21286 88005919 ~ 88006587 (-)
G452575 NA other upstream 89961 88074594 ~ 88075005 (-)
G452999 NA other upstream 610818 88595451 ~ 88596395 (-)
mast2 LOC106560530 other upstream 1167107 89140981 ~ 89465997 (-)
G453823 NA other upstream 1249592 89229699 ~ 89236608 (-)

Expression


G452504 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G452504 Expression in each Bioproject

Bar chart with 21 bars.
G452504 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network