G452575



Basic Information


Item Value
gene id G452575
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 88074594 ~ 88075005 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU512280
CCCTGTTATGATAGAACACCCTGTTTTGACAGAACACCCTGTTATGATAGAACACCCTGTTATGATAGAACACCCTGTTATGATAGAACACTCTGTTATAATAGAACACCCTGTTATGATAGAACACCCTGTTATGATAGAACACCCTGTTATGATAGAACACCCTGTTATGATAGAACACTCTGTTATAATAGAACACCCTGTTATAATAGAACACCCTGTTTTGACAGAACACCCTGAACTCCCCCAATCATCTGCTTTTCCTGCTCCAACTCTGTGTTCCTCCCATCTTTGATTACAGAGCTGTGCCTTCAGTTGCCCGTAGCAACGCTGTGTCAGACTTTAATTGCAGCTCTCCAAGAGTTCCTGGTTCATTCGAGGTGTTCCGGGCATACCGCTCTGTGCCGGTGAC

Function


NR:

description
PREDICTED: formin-2-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU512280 True 412 TUCP 0.44 1 88074594 88075005

Neighbor


gene id symbol gene type direction distance location
LOC110523029 LOC106584023 coding downstream 25491 87685213 ~ 88049103 (-)
LOC110522895 NA coding downstream 415074 87657929 ~ 87659520 (-)
usp1 usp1 coding downstream 554544 87505749 ~ 87520050 (-)
angptl3 LOC106584028 coding downstream 650526 87419230 ~ 87424068 (-)
atg4c atg4c coding downstream 673181 87391661 ~ 87401413 (-)
LOC110524751 LOC106560521 coding upstream 187570 88262575 ~ 88268140 (-)
ap1m3 LOC106560519 coding upstream 230923 88305928 ~ 88348088 (-)
c5h1orf210 LOC106560518 coding upstream 273328 88348333 ~ 88355068 (-)
orc1 orc1 coding upstream 326925 88401930 ~ 88412796 (-)
LOC110524758 LOC106560512 coding upstream 342412 88417417 ~ 88419175 (-)
G452557 NA non-coding downstream 16949 88057376 ~ 88057645 (-)
G452556 NA non-coding downstream 17752 88056598 ~ 88056842 (-)
G452555 NA non-coding downstream 18242 88056134 ~ 88056352 (-)
G452551 NA non-coding downstream 23635 88050695 ~ 88050959 (-)
G452543 NA non-coding downstream 32484 88041835 ~ 88042110 (-)
G452577 NA non-coding upstream 3885 88078890 ~ 88079128 (-)
G452578 NA non-coding upstream 5495 88080500 ~ 88080729 (-)
G452581 NA non-coding upstream 6948 88081953 ~ 88082438 (-)
G452597 NA non-coding upstream 31927 88106932 ~ 88107172 (-)
G452599 NA non-coding upstream 32324 88107329 ~ 88107559 (-)
G452517 NA other downstream 68007 88005919 ~ 88006587 (-)
G452504 NA other downstream 89961 87983960 ~ 87984633 (-)
G452457 NA other downstream 179382 87894732 ~ 87895212 (-)
G452442 NA other downstream 208130 87860127 ~ 87866464 (-)
G452999 NA other upstream 520446 88595451 ~ 88596395 (-)
mast2 LOC106560530 other upstream 1076735 89140981 ~ 89465997 (-)
G453823 NA other upstream 1159220 89229699 ~ 89236608 (-)
G453915 NA other upstream 1366579 89441584 ~ 89442377 (-)
trmt1l trmt1l other upstream 1734030 89798954 ~ 89812313 (-)

Expression


G452575 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G452575 Expression in each Bioproject

Bar chart with 3 bars.
G452575 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network