XLOC_023663 (crp6)


Basic Information

Item Value
gene id XLOC_023663
gene name crp6
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007135.7
NCBI id CM002908.2
chromosome length 42172926
location 38130604 ~ 38131381 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00046703
ATGTTGGGCTTTATTTTCACTCTGCTCATTCTGACACCAGCAGCTGCTGAAGTGGGTCTTGGTGGAAAAGTTCTTTTGTTTCAAACCCAAACTGCTACCAGTTATGTTAAACTGACTCCTGATAAACCCCTGAGTCTGTCAGCGTTTACTCTCTGCATGCGTGTGGCGACCGAGCTGCTGGGCGAGCGATCGGTCATTCTGTTCGCCTACCGCACTTCTGAAGTTGATGAACTCAATGTGTGGAGACGGAAAAATGGCAGTGTGGGTTTGTTTATTCAGACTAGTAGCAATCCAGCAAGTTTCTATCTTCCCCCTCTCTCCACATTTCAGACACATCTGTGTGTGTCCTGGGAGTCTGCAACTGGTCTTACTGCTTTTTGGGTGGACGGGCGTCGCAGTTTGTACCAGATCTATAAGAAAGATGCCTCTGTCAGACCTGGCGGCACCGTACTGCTCGGACAGGACCCTGACTCATATGTAGGTTCGTTTGACGCAAATCAGTGCTTTATTGGTGAAATTACAGATGTGAAACTGTGGGATTATGTTCTGTCTGAGATCCAGATTAAGGCTTTGTATTCAAACCAGGATCCGTTGGTGCCAGCGGGAAATGTGTTTGACTGGGACACCGTCAAATATGATGTTGTTGGAAATGTGACGGTGGCTAATGATAATCACTGA

Function

symbol description
crp6 Predicted to enable metal ion binding activity. Predicted to be located in extracellular region. Human ortholog(s) of this gene implicated in several diseases, including Kawasaki disease; autoimmune disease (multiple); macular degeneration (multiple); middle cerebral artery infarction; and nephritis (multiple). Orthologous to human CRP (C-reactive protein) and APCS (amyloid P component, serum).

GO:

id name namespace
GO:0005576 extracellular region cellular_component
GO:0046872 metal ion binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-060503-881 Predicted to enable metal ion binding activity. Predicted to be located in extracellular region. Human ortholog(s) of this gene implicated in several diseases, including Kawasaki disease; autoimmune disease (multiple); macular degeneration (multiple); middle cerebral artery infarction; and nephritis (multiple). Orthologous to human CRP (C-reactive protein) and APCS (amyloid P component, serum).

Ensembl:

ensembl_id ENSDARG00000071457

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00046703 True 678 mRNA 0.47 2 38130604 38131381

Neighbor

gene id symbol gene type direction distance location
XLOC_023662 si:ch211-234p6.9 coding downstream 8483 38121403 ~ 38122121 (-)
XLOC_023661 crp2 coding downstream 17396 38109799 ~ 38113208 (-)
XLOC_023660 BX001030.1 coding downstream 30929 38098896 ~ 38099675 (-)
XLOC_023659 crp3 coding downstream 33299 38092608 ~ 38097305 (-)
XLOC_023658 BX001030.2 coding downstream 38016 38085317 ~ 38092588 (-)
XLOC_023664 crp7 coding upstream 6092 38137473 ~ 38192003 (-)
XLOC_023666 igic1s1 coding upstream 62755 38194136 ~ 38197040 (-)
XLOC_023667 NA coding upstream 66457 38197838 ~ 38215482 (-)
XLOC_023668 igl3v5 coding upstream 70917 38202298 ~ 38205136 (-)
XLOC_023669 NA coding upstream 79722 38211103 ~ 38212927 (-)
XLOC_023665 dre-mir-735 misc upstream 46580 38177961 ~ 38178027 (-)
XLOC_023652 NA non-coding downstream 403655 37724974 ~ 37726949 (-)
XLOC_023651 NA non-coding downstream 422553 37705626 ~ 37708051 (-)
XLOC_023644 CU469584.1 non-coding downstream 726138 37361189 ~ 37404466 (-)
XLOC_023670 NA non-coding upstream 109793 38241174 ~ 38252296 (-)
XLOC_023673 CU681836.1 non-coding upstream 265191 38396572 ~ 38397488 (-)
XLOC_023674 CU681836.2 non-coding upstream 315499 38446880 ~ 38447958 (-)

Expression


Co-expression Network