G456764



Basic Information


Item Value
gene id G456764
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 92962751 ~ 92967673 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU517291
gttacggtgagtgaatgaggacccaaaagcgaactaacttaaacagagcttctttaataaccaaacataggtaggctcagatagaccggcagattccgacaggacaggacaaggttacagcaaacatgacgacagtctggttcaggcatgaaacacaacaaacaagaatccgacaaggacaggaacaaaaacagagagagatataggggactaatcagagggaaaaggggaacaggtgggagaaggggtgacgaggtagtcaagag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU517291 True 266 lncRNA 0.46 2 92962751 92967673
Loading

Neighbor


gene id symbol gene type direction distance location
si:ch211-284e20.8 LOC106560590 coding upstream 8553 92942035 ~ 92957717 (+)
fetub LOC106560589 coding upstream 31133 92927124 ~ 92931618 (+)
ahsg1 LOC106560588 coding upstream 55572 92881372 ~ 92907179 (+)
si:ch211-262h13.5 LOC106560587 coding upstream 87175 92869491 ~ 92875576 (+)
ncbp2 ncbp2 coding upstream 327850 92632817 ~ 92634901 (+)
hps3 hps3 coding downstream 828 92968501 ~ 93001381 (+)
tm4sf4 LOC106560595 coding downstream 124356 93092029 ~ 93098602 (+)
LOC110524836 rpl36 coding downstream 254157 93221830 ~ 93225091 (+)
enc3 LOC106560599 coding downstream 283956 93251629 ~ 93267778 (+)
LOC118964735 NA coding downstream 657759 93625432 ~ 93628212 (+)
G456729 NA non-coding upstream 28934 92931926 ~ 92933817 (+)
G456714 NA non-coding upstream 57041 92890594 ~ 92905710 (+)
G456715 NA non-coding upstream 57568 92903952 ~ 92905183 (+)
G456702 NA non-coding upstream 112489 92849353 ~ 92850262 (+)
G456731 cp non-coding downstream 34330 93002003 ~ 93041462 (+)
G456742 NA non-coding downstream 56618 93024291 ~ 93029202 (+)
G456744 NA non-coding downstream 81681 93049354 ~ 93051144 (+)
G456783 NA non-coding downstream 94808 93062481 ~ 93062746 (+)
G456788 NA non-coding downstream 104987 93072660 ~ 93072878 (+)
G456139 LOC106560602 other upstream 961993 91943154 ~ 92000758 (+)
dda1 LOC106560571 other upstream 1282020 91678060 ~ 91681757 (+)
G455469 NA other upstream 1472761 91487745 ~ 91489990 (+)
G455211 NA other upstream 1900130 91061090 ~ 91062621 (+)
G455203 LOC106560548 other upstream 1968452 90993865 ~ 90994299 (+)
G456927 NA other downstream 381121 93348794 ~ 93349619 (+)
LOC110524846 LOC106560502 other downstream 767171 93722660 ~ 93780941 (+)
G458015 NA other downstream 1168245 94135918 ~ 94136269 (+)

Expression


G456764 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G456764 Expression in each Bioproject

Bar chart with 16 bars.
G456764 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network