G457696



Basic Information


Item Value
gene id G457696
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 93292025 ~ 93292500 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU518424
CTTTAACAGTTCTGTCCTGTACAGACTGAATACGGTTCTCTTTAACAGTCCTGTCCTGTACAGACTGAATACGGTTCTCTTTAACAGTTCTGTCCTGTACAGACTGAATACGGTTCTCTTTAACAGTTCTGTCCTGTACAGACTGAATACGGTTCTCTTTAACAGTCCTGTCCTGTACAGACTGAACCCGGTTCTCTTTAACAGTTCTGTCCTGTACAGACTGAATACGGTTATCTTTGACTGTCCTGTACAGACTGAACCTGGTTCTCTTTAACAGTCCTGTCCTGTACAGACTGAATACGGTTCTCTTTAACAGTTCTGTCC

Function


NR:

description
PREDICTED: vascular endothelial growth factor receptor 3-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU518424 True 324 lncRNA 0.43 2 93292025 93292500
Loading

Neighbor


gene id symbol gene type direction distance location
lonp1 lonp1 coding downstream 52347 93225313 ~ 93239678 (-)
lmnb2 lmnb2 coding downstream 80926 93189533 ~ 93211099 (-)
commd2 commd2 coding downstream 113518 93170834 ~ 93178507 (-)
wwtr1 LOC106560594 coding downstream 127512 93100251 ~ 93164513 (-)
LOC110522899 NA coding downstream 214022 93073370 ~ 93078003 (-)
LOC110524839 LOC106560600 coding upstream 7990 93300490 ~ 93412367 (-)
insrb LOC106583950 coding upstream 137701 93430201 ~ 93612439 (-)
use1 use1 coding upstream 347964 93640464 ~ 93652540 (-)
LOC110524842 NA coding upstream 360363 93652863 ~ 93702545 (-)
si:dkeyp-82a1.6 LOC106560500 coding upstream 413216 93705716 ~ 93709937 (-)
G457692 NA non-coding downstream 7795 93283996 ~ 93284230 (-)
G457689 NA non-coding downstream 16596 93275182 ~ 93275429 (-)
G457686 NA non-coding downstream 20401 93271418 ~ 93271624 (-)
G457685 NA non-coding downstream 20860 93270955 ~ 93271165 (-)
G457684 NA non-coding downstream 21525 93268244 ~ 93270500 (-)
G457697 NA non-coding upstream 216 93292716 ~ 93292978 (-)
G457578 NA non-coding upstream 4901 93297401 ~ 93300050 (-)
G457724 NA non-coding upstream 90462 93382962 ~ 93383296 (-)
G457772 NA non-coding upstream 258596 93551096 ~ 93551828 (-)
G457773 NA non-coding upstream 259390 93551890 ~ 93552354 (-)
G457595 NA other downstream 271745 93018394 ~ 93020280 (-)
G457537 NA other downstream 325033 92950678 ~ 92966992 (-)
G457534 NA other downstream 348500 92940506 ~ 92943525 (-)
G457491 LOC106560589 other downstream 360386 92881393 ~ 92931639 (-)
LOC110524822 NA other downstream 661213 92629338 ~ 92630894 (-)
G457740 NA other upstream 149400 93441900 ~ 93442413 (-)
G457742 NA other upstream 169852 93462352 ~ 93463079 (-)
G457909 NA other upstream 568346 93860846 ~ 93863614 (-)
G459282 NA other upstream 2266190 95558690 ~ 95559210 (-)
G459323 NA other upstream 2309923 95602423 ~ 95602927 (-)

Expression


G457696 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G457696 Expression in each Bioproject

Bar chart with 5 bars.
G457696 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network