G457740



Basic Information


Item Value
gene id G457740
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 93441900 ~ 93442413 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU518477
caggggataccggtacagagtcaatgtggagactatatacagggggtaccggtacagagtcaatgtggaggctgtatacaggggataccggtacagagtcaatgtggagactatatacagggggtaccggtacagagtcaatgtggaggctatatatacagggggtaccggtacagagtcaatgtggaggttatatacagggggtaccggtacagagtcaatgtggagactatatacagggtattacggtacagagtcaatgtggaggctatatacagggtattacggtacagagtcaatgtggaggctatatacagggtgtaccggtacagagtcaatgtggagactatatacagggggtactggtacagagtcaatgtgg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU518477 True 382 TUCP 0.48 2 93441900 93442413
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110524839 LOC106560600 coding downstream 29533 93300490 ~ 93412367 (-)
lonp1 lonp1 coding downstream 202222 93225313 ~ 93239678 (-)
lmnb2 lmnb2 coding downstream 230801 93189533 ~ 93211099 (-)
commd2 commd2 coding downstream 263393 93170834 ~ 93178507 (-)
wwtr1 LOC106560594 coding downstream 277387 93100251 ~ 93164513 (-)
use1 use1 coding upstream 198051 93640464 ~ 93652540 (-)
LOC110524842 NA coding upstream 210450 93652863 ~ 93702545 (-)
si:dkeyp-82a1.6 LOC106560500 coding upstream 263303 93705716 ~ 93709937 (-)
atf6 atf6 coding upstream 367390 93809803 ~ 93934248 (-)
LOC110524879 LOC106560647 coding upstream 630575 94072988 ~ 94094473 (-)
G457724 NA non-coding downstream 58604 93382962 ~ 93383296 (-)
G457578 NA non-coding downstream 141850 93297401 ~ 93300050 (-)
G457697 NA non-coding downstream 148922 93292716 ~ 93292978 (-)
G457696 NA non-coding downstream 149400 93292025 ~ 93292500 (-)
G457692 NA non-coding downstream 157670 93283996 ~ 93284230 (-)
G457772 NA non-coding upstream 108683 93551096 ~ 93551828 (-)
G457773 NA non-coding upstream 109477 93551890 ~ 93552354 (-)
G457789 NA non-coding upstream 138874 93581287 ~ 93581578 (-)
G457805 NA non-coding upstream 174690 93617103 ~ 93617530 (-)
G457595 NA other downstream 421620 93018394 ~ 93020280 (-)
G457537 NA other downstream 474908 92950678 ~ 92966992 (-)
G457534 NA other downstream 498375 92940506 ~ 92943525 (-)
G457491 LOC106560589 other downstream 510261 92881393 ~ 92931639 (-)
LOC110524822 NA other downstream 811088 92629338 ~ 92630894 (-)
G457742 NA other upstream 19939 93462352 ~ 93463079 (-)
G457909 NA other upstream 418433 93860846 ~ 93863614 (-)
G459282 NA other upstream 2116277 95558690 ~ 95559210 (-)
G459323 NA other upstream 2160010 95602423 ~ 95602927 (-)
G459813 NA other upstream 2745055 96187468 ~ 96187983 (-)

Expression


G457740 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G457740 Expression in each Bioproject

Bar chart with 20 bars.
G457740 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network