G457873



Basic Information


Item Value
gene id G457873
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 93772256 ~ 93813897 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU518626
ctttagtgtcctaagttttcataactgtgaccttatttgcctaccgtctgtaagctgttagtgtcttaacgaccgttccccaggtgcgtgttcattaattgtttatggttcgttgaacaagcatgggaaaccgtgtttaaaccctttacaatgaagatctgtgaagttatttggatttttacaaattatctttgaaagacagggtcctgaaaaagggaagtttctttttttgctgagtttagaagcacaagcatttcgctacactcgcattaacatctgctaaccatgtgtatg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU518626 True 294 lncRNA 0.38 2 93772256 93813897
Loading

Neighbor


gene id symbol gene type direction distance location
si:dkeyp-82a1.6 LOC106560500 coding downstream 62319 93705716 ~ 93709937 (-)
LOC110524842 NA coding downstream 69711 93652863 ~ 93702545 (-)
use1 use1 coding downstream 119716 93640464 ~ 93652540 (-)
insrb LOC106583950 coding downstream 159817 93430201 ~ 93612439 (-)
LOC110524839 LOC106560600 coding downstream 359889 93300490 ~ 93412367 (-)
LOC110524879 LOC106560647 coding upstream 259091 94072988 ~ 94094473 (-)
LOC110524878 LOC106560653 coding upstream 281082 94094979 ~ 94099229 (-)
LOC110524880 LOC106592820 coding upstream 289702 94103599 ~ 94115079 (-)
scyl3 scyl3 coding upstream 351341 94165238 ~ 94174003 (-)
LOC110524883 LOC106560651 coding upstream 398579 94212476 ~ 94221154 (-)
G457872 NA non-coding downstream 1168 93770739 ~ 93771088 (-)
G457853 NA non-coding downstream 54520 93717451 ~ 93717736 (-)
G457858 NA non-coding downstream 58003 93713979 ~ 93714253 (-)
G457857 NA non-coding downstream 58621 93713400 ~ 93713635 (-)
G457855 NA non-coding downstream 59926 93711994 ~ 93712330 (-)
G457899 NA non-coding upstream 24993 93838890 ~ 93839569 (-)
G457918 NA non-coding upstream 93544 93907441 ~ 93909352 (-)
G457925 NA non-coding upstream 122314 93936211 ~ 93936439 (-)
G458136 NA non-coding upstream 145542 93959439 ~ 93960359 (-)
G458159 NA non-coding upstream 186645 94000542 ~ 94001093 (-)
G457742 NA other downstream 309177 93462352 ~ 93463079 (-)
G457740 NA other downstream 329843 93441900 ~ 93442413 (-)
G457595 NA other downstream 751976 93018394 ~ 93020280 (-)
G457537 NA other downstream 805264 92950678 ~ 92966992 (-)
G457534 NA other downstream 828731 92940506 ~ 92943525 (-)
G457909 NA other upstream 46949 93860846 ~ 93863614 (-)
G459282 NA other upstream 1744793 95558690 ~ 95559210 (-)
G459323 NA other upstream 1788526 95602423 ~ 95602927 (-)
G459813 NA other upstream 2373571 96187468 ~ 96187983 (-)
G460020 NA other upstream 2647010 96460907 ~ 96464598 (-)

Expression


G457873 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G457873 Expression in each Bioproject

Bar chart with 19 bars.
G457873 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network