G458015


Basic Information

Item Value
gene id G458015
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 94135918 ~ 94136269 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU518812
gcaaccccacacatttatggtctcaggatgctttactgttggcatgccacaggactgatggtagcgctcaccttgtcttctctggacaagcttttttccggatgccccaaacaatcggaaaagggattcatcagagaaaatgactttaccccagtcctcagcagtccaatccctgtacctttgcagaatatcagtctgtccctgatgtttttcttggagagaagtggcttatttgctgcccttcttgacaccaggccatcctccaaaagtcttcgcctcactgtgcgtgcagatgcactcacacctgcctgctgccattcctgagcaagctctgtactggtggtgccccgat

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU518812 True 352 TUCP 0.51 1 94135918 94136269
Loading

Neighbor

gene id symbol gene type direction distance location
si:dkey-51e6.1 LOC106560654 coding upstream 2390 94131671 ~ 94133528 (+)
lmx1a LOC106592664 coding upstream 72758 94019575 ~ 94063160 (+)
rxrgb LOC106560629 coding upstream 117392 93940018 ~ 94018526 (+)
olfml2ba LOC106560501 coding upstream 338612 93781347 ~ 93797306 (+)
LOC110524846 LOC106560502 coding upstream 354977 93722660 ~ 93780941 (+)
c5h1orf112 cssa10h1orf112 coding downstream 9175 94145444 ~ 94164607 (+)
LOC118964736 NA coding downstream 44995 94181264 ~ 94185109 (+)
LOC110523054 LOC106592820 coding downstream 55378 94191647 ~ 94201341 (+)
LOC110524884 kat3 coding downstream 84769 94221038 ~ 94235488 (+)
dzip1l LOC106560612 coding downstream 943105 95079374 ~ 95109953 (+)
G457987 NA non-coding upstream 23354 94109893 ~ 94112564 (+)
G457986 LOC106560647 non-coding upstream 57769 94073857 ~ 94078149 (+)
G457984 NA non-coding upstream 62724 94066907 ~ 94073194 (+)
G457978 NA non-coding upstream 71276 94064434 ~ 94064642 (+)
G457975 NA non-coding upstream 86602 94049093 ~ 94049316 (+)
G458030 NA non-coding downstream 18488 94154757 ~ 94155485 (+)
G458039 NA non-coding downstream 36275 94172544 ~ 94174037 (+)
G458043 NA non-coding downstream 42426 94178695 ~ 94178911 (+)
G458058 LOC100194703 non-coding downstream 83879 94220148 ~ 94220371 (+)
G456927 NA other upstream 786299 93348794 ~ 93349619 (+)
LOC110524836 rpl36 other upstream 910827 93221830 ~ 93225091 (+)
G456731 cp other upstream 1094456 93002003 ~ 93041462 (+)
G456139 LOC106560602 other upstream 2135160 91943154 ~ 92000758 (+)
G459346 hdlbp other downstream 1566711 95696263 ~ 95706519 (+)
G459843 NA other downstream 2111017 96247286 ~ 96247962 (+)
ryk LOC106560633 other downstream 2338805 96474920 ~ 96619822 (+)
G460428 NA other downstream 2786063 96922332 ~ 96922812 (+)
G461121 jade3 other downstream 3678098 97812808 ~ 97815973 (+)

Expression

G458015 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G458015 Expression in each Bioproject

Bar chart with 20 bars.
G458015 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G265382 NA non-coding CI01000063 null 6041043 ~ 6053411 (+)