G458043



Basic Information


Item Value
gene id G458043
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 94178695 ~ 94178911 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU518853
atgtctgagtgttggagagtgcccctggctatctgtaatgatgtctgagtgttggagagtgcccctggctatctgtaaatgatgtctgagtgttggagagtgcccctggctatctgtaaattatgtctgagtgttggagagtgcccctggctatctgtaatgatgtctgagtgttggagagtgcccctggctatctgtaatgatgtctgagtgttgg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU518853 True 217 lncRNA 0.49 1 94178695 94178911
Loading

Neighbor


gene id symbol gene type direction distance location
c5h1orf112 cssa10h1orf112 coding upstream 14088 94145444 ~ 94164607 (+)
si:dkey-51e6.1 LOC106560654 coding upstream 45167 94131671 ~ 94133528 (+)
lmx1a LOC106592664 coding upstream 115535 94019575 ~ 94063160 (+)
rxrgb LOC106560629 coding upstream 160169 93940018 ~ 94018526 (+)
olfml2ba LOC106560501 coding upstream 381389 93781347 ~ 93797306 (+)
LOC118964736 NA coding downstream 2353 94181264 ~ 94185109 (+)
LOC110523054 LOC106592820 coding downstream 12736 94191647 ~ 94201341 (+)
LOC110524884 kat3 coding downstream 42127 94221038 ~ 94235488 (+)
dzip1l LOC106560612 coding downstream 900463 95079374 ~ 95109953 (+)
LOC118964737 NA coding downstream 1459832 95638743 ~ 95647110 (+)
G458039 NA non-coding upstream 4658 94172544 ~ 94174037 (+)
G458030 NA non-coding upstream 23210 94154757 ~ 94155485 (+)
G457987 NA non-coding upstream 66131 94109893 ~ 94112564 (+)
G457986 LOC106560647 non-coding upstream 100546 94073857 ~ 94078149 (+)
G457984 NA non-coding upstream 105501 94066907 ~ 94073194 (+)
G458058 LOC100194703 non-coding downstream 41237 94220148 ~ 94220371 (+)
G458060 NA non-coding downstream 57753 94236664 ~ 94236900 (+)
G458040 NA non-coding downstream 58998 94237909 ~ 94238691 (+)
G458063 NA non-coding downstream 66815 94245726 ~ 94246579 (+)
G458015 NA other upstream 42426 94135918 ~ 94136269 (+)
LOC110524846 LOC106560502 other upstream 433700 93722660 ~ 93780941 (+)
G456927 NA other upstream 829076 93348794 ~ 93349619 (+)
LOC110524836 rpl36 other upstream 953604 93221830 ~ 93225091 (+)
G456731 cp other upstream 1137233 93002003 ~ 93041462 (+)
G459346 hdlbp other downstream 1524069 95696263 ~ 95706519 (+)
G459843 NA other downstream 2068375 96247286 ~ 96247962 (+)
ryk LOC106560633 other downstream 2296163 96474920 ~ 96619822 (+)
G460428 NA other downstream 2743421 96922332 ~ 96922812 (+)
G461121 jade3 other downstream 3635456 97812808 ~ 97815973 (+)

Expression


G458043 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G458043 Expression in each Bioproject

Bar chart with 13 bars.
G458043 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 15.
End of interactive chart.

Co-expression Network