G460428



Basic Information


Item Value
gene id G460428
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 96922332 ~ 96922812 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU521776
GAATTAAATAGAGCACTGTTTTATATTGTATCGCTATGGTTGAAGCATTAAATGAGATATGAACTTAAATATGTGTCTTGCCAAAGACCCGACCGTCACGTGGCTGGAATATTGAGTCCCAGGAGCACTTCTGTTACATGTGAAAACCTCCCTTCTGTTACATGTGAAAACCTCCCTTCTGTTACATGTGAAAACCTCCCTTCTGTTACATGTGAAAACCTCCCTTCTGTTACATGTGAAAACCTCCCTTCTGTTACATGTGAAAACCTCCTTTCTGTTACATGTGAAAACCTCCTTTCTGTTACATGTGAAAACCTCCCTTCTGTTACATGTGAAAACCTCCCTTCTGTTACATGTGAAAACCTCCCTTCTGTTACATGTGAAAACCTCCTTTCTGTTACATGTGAAAACCTCCCTTCTGTTACATGTGAAAACCTCCCTTCTGTTACATGTGAAAACCTCCCTTCTGTTACATGTGAAA

Function


NR:

description
PREDICTED: uncharacterized protein LOC106604339

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU521776 True 481 TUCP 0.40 1 96922332 96922812

Neighbor


gene id symbol gene type direction distance location
LOC110524861 LOC106560623 coding upstream 7688 96900978 ~ 96914644 (+)
LOC118964702 LOC107552273 coding upstream 97556 96678172 ~ 96824776 (+)
LOC110524858 LOC106560616 coding upstream 245943 96626273 ~ 96676389 (+)
ryk LOC106560633 coding upstream 302510 96474920 ~ 96619822 (+)
sned1 LOC106560632 coding upstream 452412 96334400 ~ 96469920 (+)
LOC110524860 LOC106560624 coding downstream 21195 96944007 ~ 96988740 (+)
LOC110523043 LOC106560627 coding downstream 76133 96998945 ~ 97068968 (+)
gpr17 gpr17 coding downstream 154978 97077790 ~ 97093253 (+)
LOC110524859 inpp5d coding downstream 175738 97098550 ~ 97143683 (+)
LOC110524865 NA coding downstream 241227 97164039 ~ 97166955 (+)
G460426 NA non-coding upstream 655 96921430 ~ 96921677 (+)
G460392 NA non-coding upstream 39090 96883032 ~ 96883242 (+)
G460390 NA non-coding upstream 39784 96881076 ~ 96882548 (+)
G460190 NA non-coding upstream 56973 96864904 ~ 96865359 (+)
G460077 NA non-coding upstream 91191 96829234 ~ 96831141 (+)
G460445 NA non-coding downstream 11347 96934159 ~ 96939430 (+)
G460454 NA non-coding downstream 35778 96958590 ~ 96958852 (+)
G460457 NA non-coding downstream 43172 96965984 ~ 96969200 (+)
G460459 NA non-coding downstream 49288 96972100 ~ 96972318 (+)
G460463 NA non-coding downstream 57583 96980395 ~ 96980861 (+)
G459843 NA other upstream 674370 96247286 ~ 96247962 (+)
G459346 hdlbp other upstream 1215813 95696263 ~ 95706519 (+)
G458015 NA other upstream 2786063 94135918 ~ 94136269 (+)
LOC110524846 LOC106560502 other upstream 3177337 93722660 ~ 93780941 (+)
G461121 jade3 other downstream 891555 97812808 ~ 97815973 (+)
G461826 NA other downstream 1751444 98674256 ~ 98677063 (+)
G461827 NA other downstream 1752320 98675132 ~ 98675999 (+)
G461999 NA other downstream 1851670 98774482 ~ 98779067 (+)
G462037 NA other downstream 1909645 98832457 ~ 98834433 (+)

Expression


G460428 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G460428 Expression in each Bioproject

Bar chart with 11 bars.
G460428 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network