G461786



Basic Information


Item Value
gene id G461786
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 98577080 ~ 98579126 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU523661
TTAGAATGCAGGGTTATGACAGGTGAACATTTAGAATGCAGGGTTTTGACAGGTGAACATTTAGAATGCAGATTTTTGACAGGGTAATGTTTAGAATGCAGGGTTATGACAGGTGAACATTTAGAATGCAGGGTTTTGACAGGTGAACATTTAGAATGCAGGGTTTTGACAGGTGAACATTTAGAATGCAGGGTTTTGACAGGGTAATGTTTAGAATGCAGGGTTTTGACAGGGTAAAGTTTAGAATGC

Function


NR:

description
PREDICTED: putative uncharacterized protein FLJ45035, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU523661 True 249 lncRNA 0.39 3 98577080 98579126

Neighbor


gene id symbol gene type direction distance location
oca2 LOC106591054 coding upstream 134815 98276682 ~ 98442265 (+)
herc2 herc2 coding upstream 328191 97997425 ~ 98248889 (+)
LOC110524889 LOC106590724 coding upstream 609160 97888379 ~ 97967920 (+)
LOC118964703 NA coding upstream 614787 97960504 ~ 97962293 (+)
gtpbp6 gtpbp6 coding upstream 821925 97715395 ~ 97755155 (+)
LOC110523047 LOC106560665 coding downstream 482251 99061377 ~ 99101070 (+)
LOC110524867 bivm coding downstream 580780 99159906 ~ 99178822 (+)
LOC110523045 NA coding downstream 617214 99196283 ~ 99207807 (+)
LOC110490602 LOC106560622 coding downstream 795029 99374155 ~ 99401558 (+)
LOC118964709 NA coding downstream 1566477 100145603 ~ 100157146 (+)
G461725 NA non-coding upstream 48754 98472505 ~ 98528326 (+)
G461755 NA non-coding upstream 55340 98520962 ~ 98521740 (+)
G461718 NA non-coding upstream 109785 98467064 ~ 98467295 (+)
G461271 NA non-coding upstream 133794 98442819 ~ 98443286 (+)
G461794 NA non-coding downstream 25518 98604644 ~ 98605338 (+)
G461811 NA non-coding downstream 57151 98636277 ~ 98637700 (+)
G461826 NA non-coding downstream 95130 98674256 ~ 98677063 (+)
G461829 NA non-coding downstream 100720 98679846 ~ 98680682 (+)
G461844 NA non-coding downstream 123392 98702518 ~ 98703548 (+)
G461121 jade3 other upstream 761107 97812808 ~ 97815973 (+)
G460428 NA other upstream 1654268 96922332 ~ 96922812 (+)
ryk LOC106560633 other upstream 2045026 96474920 ~ 96619822 (+)
G459843 NA other upstream 2329118 96247286 ~ 96247962 (+)
G459346 hdlbp other upstream 2870561 95696263 ~ 95706519 (+)
G461827 NA other downstream 96006 98675132 ~ 98675999 (+)
G461999 NA other downstream 195356 98774482 ~ 98779067 (+)
G462037 NA other downstream 253331 98832457 ~ 98834433 (+)
G462233 NA other downstream 479757 99058883 ~ 99059354 (+)

Expression


G461786 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G461786 Expression in each Bioproject

Bar chart with 6 bars.
G461786 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network