G462199



Basic Information


Item Value
gene id G462199
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 99001312 ~ 99001576 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU524201
gtccttgacgatctttttggcattcctgtgacattgggtgctgtacagtcgtggccaaaagttttgagaatgacacaaatattaattttcacaaagtctgctgcctcagtttgtatgatggcaatttgcatatactccagaatgttatgaagagtgatcagatgaattgcaattaattgcaaagtccctctttgccatgcaaatgaactgaatcccccaaaaacatttccactgcatttcagccctgctacaaaaggaccagctg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU524201 True 265 lncRNA 0.41 1 99001312 99001576
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110524869 gabra5 coding downstream 88962 98839500 ~ 98912350 (-)
LOC118964708 NA coding downstream 164509 98835254 ~ 98836803 (-)
LOC110523058 gabrg3 coding downstream 255059 98488509 ~ 98746253 (-)
LOC118964706 NA coding downstream 763449 98237056 ~ 98237863 (-)
LOC118964704 NA coding downstream 764281 98236489 ~ 98237031 (-)
cnga3a LOC106560639 coding upstream 112571 99114147 ~ 99133676 (-)
LOC110523046 at233 coding upstream 302969 99304545 ~ 99331120 (-)
LOC110490603 tp63 coding upstream 400317 99401893 ~ 99531076 (-)
LOC118964739 LOC100694679 coding upstream 766190 99767766 ~ 99857583 (-)
tprg1 tprgl coding upstream 949287 99950863 ~ 100016296 (-)
G462184 NA non-coding downstream 27634 98973028 ~ 98973678 (-)
G462144 NA non-coding downstream 113487 98887012 ~ 98887825 (-)
G462139 NA non-coding downstream 125356 98871164 ~ 98875956 (-)
G462131 NA non-coding downstream 155215 98845686 ~ 98846097 (-)
G462123 NA non-coding downstream 172930 98827559 ~ 98828382 (-)
G462201 NA non-coding upstream 8196 99009772 ~ 99010456 (-)
G462226 NA non-coding upstream 49531 99051107 ~ 99051417 (-)
G462230 NA non-coding upstream 53303 99054879 ~ 99055336 (-)
G462319 NA non-coding upstream 68037 99069613 ~ 99070023 (-)
G462324 LOC106560665 non-coding upstream 76186 99077762 ~ 99085286 (-)
G462126 NA other downstream 168973 98829464 ~ 98832339 (-)
G462022 NA other downstream 200433 98795558 ~ 98800879 (-)
G461871 NA other downstream 530592 98470356 ~ 98470720 (-)
G461505 NA other downstream 918630 98082022 ~ 98082682 (-)
LOC118964707 herc2 other downstream 992928 97991094 ~ 98008384 (-)
G462621 NA other upstream 313436 99315012 ~ 99390022 (-)
G462662 LOC106560622 other upstream 392775 99394351 ~ 99394907 (-)
G463044 NA other upstream 953799 99954703 ~ 99957706 (-)
LOC110524903 LOC106613426 other upstream 1224989 100226426 ~ 100244135 (-)
LOC110524902 scml2 other upstream 1260664 100262233 ~ 100323196 (-)

Expression


G462199 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 250.
End of interactive chart.

G462199 Expression in each Bioproject

Bar chart with 21 bars.
G462199 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 7500.
End of interactive chart.

Co-expression Network