G462496



Basic Information


Item Value
gene id G462496
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048569.1
NCBI id CM023223.2
chromosome length 100798064
location 99385361 ~ 99385701 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU524646
ggaggctgttatagcagcaatgttccaacatctagtggaaagccttcccagaagagtggaggctgttatagcagcaatgttccaacatctagtggaaagccttcccagaggagtggaggctgttatagcagcaatgttccaacatctagtggaaagccttcccagaagagtggaggctgttatagcagcaatgttcctacatctagtggaaatccttcccagaagag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU524646 True 227 lncRNA 0.48 2 99385361 99385701
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110523045 NA coding upstream 177554 99196283 ~ 99207807 (+)
LOC110524867 bivm coding upstream 206539 99159906 ~ 99178822 (+)
LOC110523047 LOC106560665 coding upstream 284291 99061377 ~ 99101070 (+)
oca2 LOC106591054 coding upstream 943096 98276682 ~ 98442265 (+)
herc2 herc2 coding upstream 1136472 97997425 ~ 98248889 (+)
LOC118964709 NA coding downstream 759902 100145603 ~ 100157146 (+)
si:ch211-121a2.4 LOC106560711 coding downstream 797226 100182927 ~ 100191165 (+)
LOC110524906 NA coding downstream 838510 100224211 ~ 100226348 (+)
LOC110524909 LOC106921341 coding downstream 1034566 100420267 ~ 100449778 (+)
LOC118964711 NA coding downstream 1280446 100666147 ~ 100667320 (+)
G462493 NA non-coding upstream 2963 99381783 ~ 99382398 (+)
LOC110490602 LOC106560622 non-coding upstream 7256 99374155 ~ 99401558 (+)
G462481 NA non-coding upstream 29118 99354674 ~ 99356243 (+)
G462476 NA non-coding upstream 39954 99344451 ~ 99345407 (+)
G462466 NA non-coding upstream 55732 99328979 ~ 99329629 (+)
G462509 NA non-coding downstream 31171 99416872 ~ 99419061 (+)
G462510 NA non-coding downstream 32340 99418041 ~ 99419480 (+)
G462514 NA non-coding downstream 37919 99423620 ~ 99423968 (+)
G462517 NA non-coding downstream 43721 99429422 ~ 99486779 (+)
G462557 NA non-coding downstream 111813 99497514 ~ 99498131 (+)
G462233 NA other upstream 326007 99058883 ~ 99059354 (+)
G462037 NA other upstream 552450 98832457 ~ 98834433 (+)
G461999 NA other upstream 606294 98774482 ~ 98779067 (+)
G461827 NA other upstream 709362 98675132 ~ 98675999 (+)
G462549 NA other downstream 97682 99483383 ~ 99483960 (+)
G462762 NA other downstream 680868 100050135 ~ 100089049 (+)
G463119 NA other downstream 785436 100171137 ~ 100171897 (+)
G463139 NA other downstream 840803 100226504 ~ 100230232 (+)
G463164 NA other downstream 883860 100269561 ~ 100291594 (+)

Expression


G462496 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G462496 Expression in each Bioproject

Bar chart with 17 bars.
G462496 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network