G464913



Basic Information


Item Value
gene id G464913
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 1461139 ~ 1462477 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU527917
ACATTACAATATCTGCATTACTATATCTGGAGGGCTAAATCTGACTAACCTAGCAATATCTGCATTACAATATCTGCATTACAATATCTGGCTATATCTGGAGGGCTAAATCTGACTAACCTAGCAATATCTACATTACTATATCTGGAGGGCTAAATCGGACTAACCTAGCAATATCTGCATTACTATATCTACATTACTATATCTGGAGGGCTAAATCGGACTAACCTAGCAATATCTGCATTACAATATCTGCATTACTATATCTGGAGGGCTAAATCGGACTAACC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU527917 True 290 lncRNA 0.37 2 1461139 1462477

Neighbor


gene id symbol gene type direction distance location
slc4a4a LOC101484802 coding upstream 342550 775664 ~ 1118589 (+)
LOC118964805 NA coding upstream 458851 997029 ~ 1002288 (+)
tars1 LOC106585996 coding upstream 858620 564277 ~ 602519 (+)
LOC118964804 NA coding upstream 905246 555164 ~ 555893 (+)
LOC110525134 NA coding upstream 906885 551781 ~ 554254 (+)
LOC110525062 LOC106570947 coding downstream 539611 2002088 ~ 2105141 (+)
LOC110525063 LOC106570939 coding downstream 686763 2149240 ~ 2199894 (+)
zfr zfr coding downstream 896145 2342330 ~ 2451362 (+)
mtmr12 mtmr12 coding downstream 947754 2410231 ~ 2446470 (+)
LOC110525158 LOC106570936 coding downstream 1003997 2466474 ~ 2489239 (+)
G464907 NA non-coding upstream 29125 1431638 ~ 1432014 (+)
G464901 NA non-coding upstream 30587 1422407 ~ 1430552 (+)
G464903 NA non-coding upstream 33304 1426055 ~ 1427835 (+)
G464902 NA non-coding upstream 37664 1422588 ~ 1423475 (+)
G464876 NA non-coding upstream 51213 1409381 ~ 1409926 (+)
G464914 NA non-coding downstream 669 1463146 ~ 1463509 (+)
G464945 NA non-coding downstream 35174 1497651 ~ 1497875 (+)
G464965 NA non-coding downstream 88529 1551006 ~ 1551223 (+)
G464967 NA non-coding downstream 91580 1554057 ~ 1555803 (+)
G464969 NA non-coding downstream 95258 1557735 ~ 1653335 (+)
G464705 NA other upstream 232040 1228705 ~ 1229099 (+)
LOC110525138 rufy3 other upstream 1002133 442716 ~ 549899 (+)
G463813 NA other upstream 1192988 265409 ~ 268151 (+)
LOC118964799 isca1 other upstream 1408649 43896 ~ 52580 (+)
G465203 NA other downstream 599851 2062328 ~ 2064067 (+)
G465355 NA other downstream 942642 2405119 ~ 2406090 (+)
LOC110525071 LOC106585963 other downstream 1342906 2743964 ~ 2866482 (+)
G465578 NA other downstream 1516365 2978842 ~ 2982425 (+)

Expression


G464913 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G464913 Expression in each Bioproject

Bar chart with 5 bars.
G464913 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network