G464973



Basic Information


Item Value
gene id G464973
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 1632366 ~ 1632629 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU528032
acacttaatgtattgtagagtagaggtctgagggaacacacttaatgtgttgtagatatgtggtagtagagtagtggtctgagggaacacacttaatgtattgtagatatgtggtagtagagtagagacacttaatgtgttgtagatatgtggtagtagagtagtggtctgagggaacacacttaatgtgttgtagatatgtggtagtagagt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU528032 True 213 lncRNA 0.38 2 1632366 1632629
Loading

Neighbor


gene id symbol gene type direction distance location
slc4a4a LOC101484802 coding upstream 513777 775664 ~ 1118589 (+)
LOC118964805 NA coding upstream 630078 997029 ~ 1002288 (+)
tars1 LOC106585996 coding upstream 1029847 564277 ~ 602519 (+)
LOC118964804 NA coding upstream 1076473 555164 ~ 555893 (+)
LOC110525134 NA coding upstream 1078112 551781 ~ 554254 (+)
LOC110525062 LOC106570947 coding downstream 369459 2002088 ~ 2105141 (+)
LOC110525063 LOC106570939 coding downstream 516611 2149240 ~ 2199894 (+)
zfr zfr coding downstream 725993 2342330 ~ 2451362 (+)
mtmr12 mtmr12 coding downstream 777602 2410231 ~ 2446470 (+)
LOC110525158 LOC106570936 coding downstream 833845 2466474 ~ 2489239 (+)
G464989 NA non-coding upstream 10325 1621412 ~ 1622041 (+)
G464979 NA non-coding upstream 30353 1600499 ~ 1602013 (+)
G464967 NA non-coding upstream 76563 1554057 ~ 1555803 (+)
G464965 NA non-coding upstream 81143 1551006 ~ 1551223 (+)
G464945 NA non-coding upstream 134491 1497651 ~ 1497875 (+)
G464999 NA non-coding downstream 901 1633530 ~ 1633915 (+)
G465025 NA non-coding downstream 48998 1681627 ~ 1685862 (+)
G465026 NA non-coding downstream 49852 1682481 ~ 1686137 (+)
G465027 NA non-coding downstream 51214 1683843 ~ 1684926 (+)
G465056 NA non-coding downstream 131155 1763784 ~ 1764159 (+)
G464705 NA other upstream 403267 1228705 ~ 1229099 (+)
LOC110525138 rufy3 other upstream 1173360 442716 ~ 549899 (+)
G463813 NA other upstream 1364215 265409 ~ 268151 (+)
LOC118964799 isca1 other upstream 1579876 43896 ~ 52580 (+)
G465203 NA other downstream 429699 2062328 ~ 2064067 (+)
G465355 NA other downstream 772490 2405119 ~ 2406090 (+)
LOC110525071 LOC106585963 other downstream 1172754 2743964 ~ 2866482 (+)
G465578 NA other downstream 1346213 2978842 ~ 2982425 (+)

Expression


G464973 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G464973 Expression in each Bioproject

Bar chart with 6 bars.
G464973 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network