G468626


Basic Information

Item Value
gene id G468626
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 5903155 ~ 5904297 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU532566
ggatctgtttgttgtccctctctctggatctgtttgttgtccctctctctctctggatctgtttgttgtccctctctctggatctgtttgttgtccctctctctctggatctgtttgttgtctctctctctctggatctgtttgttgtctctctctctctggatctgtcagttgtctctctctctctctggatctgtttgttgtctctctctctctctggatctgtttgttgtctctctctctctggatctgtttgttgtccctctctctctggatctgtttgttgtccctctctctctggatctgtttattgtccctctctctctgggtctgtttgttgtc

Function

NR:

description
remodeling and spacing factor 1 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU532566 True 342 lncRNA 0.47 3 5903155 5904297

Neighbor

gene id symbol gene type direction distance location
LOC118964810 LOC106585924 coding upstream 244672 5657268 ~ 5658483 (+)
LOC118965066 LOC106585924 coding upstream 278840 5623100 ~ 5624315 (+)
prdm8b LOC106585925 coding upstream 317637 5579774 ~ 5585518 (+)
bmp2k LOC106585926 coding upstream 967706 4842875 ~ 4935449 (+)
LOC110525066 LOC106585873 coding downstream 94529 5998826 ~ 6036553 (+)
LOC110510489 LOC106593421 coding downstream 156311 6060608 ~ 6147999 (+)
LOC118964812 LOC106607869 coding downstream 173880 6078177 ~ 6088723 (+)
LOC118964813 NA coding downstream 262646 6166943 ~ 6173411 (+)
LOC110510500 LOC106607873 coding downstream 319957 6224254 ~ 6231849 (+)
G468621 NA non-coding upstream 9733 5892997 ~ 5893422 (+)
G468483 NA non-coding upstream 137515 5765179 ~ 5765640 (+)
G468445 NA non-coding upstream 204948 5697565 ~ 5698207 (+)
G468404 NA non-coding upstream 310068 5547735 ~ 5593087 (+)
G468388 NA non-coding upstream 371292 5531630 ~ 5531863 (+)
G468668 NA non-coding downstream 21109 5925406 ~ 5926834 (+)
G468673 NA non-coding downstream 34204 5938501 ~ 5941493 (+)
G468676 NA non-coding downstream 43466 5947763 ~ 5949067 (+)
G468693 NA non-coding downstream 72053 5976350 ~ 5976796 (+)
G468690 mrpl1 non-coding downstream 78468 5982765 ~ 5997048 (+)
G466813 NA other upstream 2129815 3772864 ~ 3773340 (+)
G465578 NA other upstream 2920730 2978842 ~ 2982425 (+)
LOC110525071 LOC106585963 other upstream 3069045 2743964 ~ 2866482 (+)
zfr zfr other upstream 3493897 2342330 ~ 2451362 (+)
G468732 NA other downstream 204082 6108379 ~ 6156681 (+)
G468643 LOC106607869 other downstream 290475 6194772 ~ 6199155 (+)
G468755 NA other downstream 305902 6210199 ~ 6244501 (+)
G468768 NA other downstream 350179 6254476 ~ 6371873 (+)
G468791 NA other downstream 473342 6350096 ~ 6379704 (+)

Expression


Co-expression Network