G469048



Basic Information


Item Value
gene id G469048
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 7352186 ~ 7352578 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU533217
gtcatcatggagcagccagagcagtctgccagcatggagcagccagagctgtcagtcagcatggagcagccagagcagccagtctgtgtcgaccagtctcttccagatctgccagtcatccagactcttccagatctgccagtcgtccagactcttccagatctgccagtcgtccagactcttccagatctgccagtcgaccagactcttccagatctgccagtcgaccagactcttccagatctgcccgtcgtccagactcttccagatctgcccgtcgtccagactcttccagatctgccagtcgtccagactcttccagatctgccagtcgtccagactcttccagatctgccagtcgtccagactcttccagatctgccagtcgtccag

Function


NR:

description
PREDICTED: uncharacterized protein LOC106566445

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU533217 True 393 TUCP 0.57 1 7352186 7352578

Neighbor


gene id symbol gene type direction distance location
LOC118964838 LOC106600203 coding upstream 3774 7346075 ~ 7348412 (+)
LOC118964795 LOC106597030 coding upstream 18243 7328281 ~ 7333943 (+)
LOC118964837 LOC106600203 coding upstream 18243 7332211 ~ 7333943 (+)
LOC118936656 NA coding upstream 33039 7318606 ~ 7319147 (+)
LOC118964836 LOC106600203 coding upstream 47776 7302004 ~ 7304410 (+)
LOC110525085 LOC106585885 coding downstream 70498 7423076 ~ 7523301 (+)
LOC110525208 LOC106585897 coding downstream 181962 7534540 ~ 7600051 (+)
LOC110525210 LOC106585898 coding downstream 255548 7608126 ~ 7652997 (+)
gak gak coding downstream 515135 7867713 ~ 7909967 (+)
LOC110525087 LOC106585905 coding downstream 560929 7913507 ~ 7954724 (+)
G469047 NA non-coding upstream 1406 7350568 ~ 7350780 (+)
LOC118964833 LOC106600203 non-coding upstream 83658 7226101 ~ 7268528 (+)
G468991 NA non-coding upstream 89617 7260552 ~ 7262569 (+)
G468990 NA non-coding upstream 91687 6940787 ~ 7260499 (+)
G468982 NA non-coding upstream 103101 6896005 ~ 7249085 (+)
G469492 NA non-coding downstream 4588 7357166 ~ 7357463 (+)
G469498 NA non-coding downstream 14387 7366965 ~ 7367188 (+)
G469500 NA non-coding downstream 16448 7369026 ~ 7369331 (+)
G469501 NA non-coding downstream 16927 7369505 ~ 7369907 (+)
G469528 NA non-coding downstream 47709 7400287 ~ 7400584 (+)
ccl19a.1 LOC106585878 other upstream 610693 6719880 ~ 6741493 (+)
ccl19a.2 LOC106585882 other upstream 639149 6710688 ~ 6713091 (+)
G468887 sdf2l other upstream 677799 6672508 ~ 6674387 (+)
G468841 LOC106590901 other upstream 799091 6550977 ~ 6557058 (+)
G468765 LOC106607873 other upstream 863768 6423414 ~ 6488418 (+)
G470292 NA other downstream 860702 8213280 ~ 8217274 (+)
G470599 NA other downstream 1457395 8809973 ~ 8810943 (+)
G470770 NA other downstream 1870773 9223351 ~ 9225513 (+)
LOC110525088 LOC106585913 other downstream 1915800 9228570 ~ 9273994 (+)

Expression


G469048 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G469048 Expression in each Bioproject

Bar chart with 20 bars.
G469048 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network