G469879



Basic Information


Item Value
gene id G469879
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 7911796 ~ 7911996 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU534239
taatgtttcagcttatttctattgtatgtaaagaatccaaacagtacatctctccacaatagtgtaaaatcttcataaatgtgttcaattataaacctactgatgtcttgccacagttttcttacatgcatacaatgccaaaaaagatgcaacactgtttctgggtggtcattacaaaaggagcaatttgagttgatgttt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU534239 True 201 lncRNA 0.33 1 7911796 7911996

Neighbor


gene id symbol gene type direction distance location
gak gak coding upstream 1829 7867713 ~ 7909967 (+)
LOC110525210 LOC106585898 coding upstream 258799 7608126 ~ 7652997 (+)
LOC110525208 LOC106585897 coding upstream 311745 7534540 ~ 7600051 (+)
LOC110525085 LOC106585885 coding upstream 388495 7423076 ~ 7523301 (+)
LOC118964838 LOC106600203 coding upstream 563384 7346075 ~ 7348412 (+)
LOC110525087 LOC106585905 coding downstream 1511 7913507 ~ 7954724 (+)
lifra LOC106585909 coding downstream 999356 8911352 ~ 8936882 (+)
spef2 LOC106585910 coding downstream 1025086 8937082 ~ 8984264 (+)
slc1a3a LOC106585918 coding downstream 1110447 9022443 ~ 9056766 (+)
nipbla LOC105014587 coding downstream 1164201 9076197 ~ 9118856 (+)
G469878 NA non-coding upstream 745 7910846 ~ 7911051 (+)
G469877 NA non-coding upstream 1015 7910558 ~ 7910781 (+)
G469871 NA non-coding upstream 27594 7883899 ~ 7884202 (+)
G469856 wdr31 non-coding upstream 53385 7855152 ~ 7858411 (+)
G469853 NA non-coding upstream 59655 7850351 ~ 7852141 (+)
G469880 NA non-coding downstream 82 7912078 ~ 7912404 (+)
G469885 NA non-coding downstream 15684 7927680 ~ 7999885 (+)
G469889 NA non-coding downstream 20462 7932458 ~ 7933126 (+)
G470162 NA non-coding downstream 169194 8081190 ~ 8081420 (+)
G470232 NA non-coding downstream 220932 8132928 ~ 8133165 (+)
G469048 NA other upstream 559218 7352186 ~ 7352578 (+)
ccl19a.1 LOC106585878 other upstream 1170303 6719880 ~ 6741493 (+)
ccl19a.2 LOC106585882 other upstream 1198759 6710688 ~ 6713091 (+)
G468887 sdf2l other upstream 1237409 6672508 ~ 6674387 (+)
G470292 NA other downstream 301284 8213280 ~ 8217274 (+)
G470599 NA other downstream 897977 8809973 ~ 8810943 (+)
G470770 NA other downstream 1311355 9223351 ~ 9225513 (+)
LOC110525088 LOC106585913 other downstream 1356382 9228570 ~ 9273994 (+)
G472364 NA other downstream 2368310 10280306 ~ 10281123 (+)

Expression


G469879 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G469879 Expression in each Bioproject

Bar chart with 17 bars.
G469879 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network