G469889



Basic Information


Item Value
gene id G469889
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048570.1
NCBI id CM023224.2
chromosome length 101096859
location 7932458 ~ 7933126 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU534251
ggtaggctagttgagaacatctttatttaaccaggtaggccagttgagaacatctttatttaaccaggtaggccagttgagaacacctttatttaaccaggtaggctagttgagaacatctttatttaaccaggtaggccagttgagaacatctttatttaaccaggtaggccagttgagaacacctttatttaaccaggtaggctagttgagaacatctttatttaaccaggtaggccagttgagaacacctttatttaaccaggtagactagttgagaacacctttatttaaccaggtagactagttgagaacacctttatttaaccaggtaggctagttgagaacacctttatttaaccaggtaggctagttgagaacaagttctcatttgcaactgcgacctggccaagataaagcatagcagtatgagcagacaacacagagttacacatggagtaaacaattaac

Function


NR:

description
PREDICTED: uncharacterized protein LOC106587709, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU534251 True 471 lncRNA 0.40 2 7932458 7933126

Neighbor


gene id symbol gene type direction distance location
gak gak coding upstream 22491 7867713 ~ 7909967 (+)
LOC110525210 LOC106585898 coding upstream 279461 7608126 ~ 7652997 (+)
LOC110525208 LOC106585897 coding upstream 332407 7534540 ~ 7600051 (+)
LOC110525085 LOC106585885 coding upstream 409157 7423076 ~ 7523301 (+)
LOC118964838 LOC106600203 coding upstream 584046 7346075 ~ 7348412 (+)
lifra LOC106585909 coding downstream 978226 8911352 ~ 8936882 (+)
spef2 LOC106585910 coding downstream 1003956 8937082 ~ 8984264 (+)
slc1a3a LOC106585918 coding downstream 1089317 9022443 ~ 9056766 (+)
nipbla LOC105014587 coding downstream 1143071 9076197 ~ 9118856 (+)
LOC110525223 ndc80 coding downstream 1185842 9118968 ~ 9135047 (+)
G469880 NA non-coding upstream 20054 7912078 ~ 7912404 (+)
G469879 NA non-coding upstream 20462 7911796 ~ 7911996 (+)
G469878 NA non-coding upstream 21407 7910846 ~ 7911051 (+)
G469877 NA non-coding upstream 21677 7910558 ~ 7910781 (+)
G469871 NA non-coding upstream 48256 7883899 ~ 7884202 (+)
G470162 NA non-coding downstream 148064 8081190 ~ 8081420 (+)
G470232 NA non-coding downstream 199802 8132928 ~ 8133165 (+)
G470245 NA non-coding downstream 210275 8143401 ~ 8143627 (+)
G470248 NA non-coding downstream 210611 8143737 ~ 8144552 (+)
G470250 NA non-coding downstream 211767 8144893 ~ 8145269 (+)
G469048 NA other upstream 579880 7352186 ~ 7352578 (+)
ccl19a.1 LOC106585878 other upstream 1190965 6719880 ~ 6741493 (+)
ccl19a.2 LOC106585882 other upstream 1219421 6710688 ~ 6713091 (+)
G468887 sdf2l other upstream 1258071 6672508 ~ 6674387 (+)
G470292 NA other downstream 280154 8213280 ~ 8217274 (+)
G470599 NA other downstream 876847 8809973 ~ 8810943 (+)
G470770 NA other downstream 1290225 9223351 ~ 9225513 (+)
LOC110525088 LOC106585913 other downstream 1335252 9228570 ~ 9273994 (+)
G472364 NA other downstream 2347180 10280306 ~ 10281123 (+)

Expression


G469889 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G469889 Expression in each Bioproject

Bar chart with 17 bars.
G469889 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network